M1000 fluorimeter plate reader

E. coli BL21(DE3) cells and the plasmid pET22b(+) were from EMD Millipore. 6-FAM–dArU(dA)₂–6-TAMRA, a fluorogenic ribonuclease substrate, as well as DNA oligonucleotides for PCR, sequencing, and mutagenesis were from Integrated DNA Technologies. Protein purification columns were from GE Healthcare. Costar 96-well NBS microtiter plates were from Corning Life Sciences. Restriction and PCR enzymes were from Promega. All other chemicals were of commercial grade or better and were used without further purification.
The molecular mass of each RI and ribonuclease was determined by matrix-assisted laser desorption/ionization-time-of-flight (MALDI–TOF) mass spectrometry using a Voyager-DE-PRO Biospectrometry Workstation (Applied Biosystems). MALDI–TOF mass spectrometry experiments were performed at the campus Biophysics Instrumentation Facility. All fluorescence and absorbance measurements were made using a Tecan M1000 fluorimeter plate reader, unless stated otherwise. All data were fit and analyzed using the graphing software package Prism 5 (GraphPad), unless stated otherwise.

E. coli BL21(DE3) cells and plasmid pET22b(+) were from EMD Millipore. 6‐FAM–dArUdAdA–6-TAMRA, 5,6-FAM–d(CGATC)(rU)d(ACTGCAACGGCAGTAGATCG), and DNA oligonucleotides for PCR, sequencing, and mutagenesis were from Integrated DNA Technologies. Poly(A:U) was from Sigma Chemical; low-molecular-weight poly(I:C) was from InvivoGen. Sulfatides, phosphatidylserine, and cetyltrimethylammonium bromide (CTAB) were from Avanti Polar Lipids.
Protein purification columns were from GE Healthcare. Restriction and PCR enzymes were from Promega. 96-Well plates were from Corning. 2-(N-Morpholino)ethanesulfonic acid (MES) was purified to be free of oligo(vinylsulfonic acid) [42 (link)]. All other chemicals were of commercial grade or better, and were used without further purification.
The molecular mass of each ribonuclease was determined by matrix-assisted laser desorption/ionization-time-of-flight (MALDI–TOF) mass spectrometry with a Voyager-DE-PRO Biospectrometry Workstation from Applied Biosystems at the campus Biophysics Instrumentation Facility. All fluorescence and absorbance measurements were made with a M1000 fluorimeter plate reader from Tecan, unless stated otherwise. All data were fitted and analyzed using Prism 5 software from GraphPad, unless stated otherwise.