Foxo1 antibody

H9C2 myoblasts were treated with 1% formaldehyde for 10 minutes to cross-link proteins and chromatin. The reaction was stopped by adding 0.125 M Glycine for 5 minutes. Cells were washed with cold PBS twice. Cells were then resuspended in 1 ml ChIP lysis buffer (20 mM Tris-HCl (pH 8.0), 85 mM KCl, 0.5% NP-40) for 10 minutes at 4°C and centrifuged at 5,000 rpm to pellet the nuclei. The cell nuclei were resuspended in 400 μL nuclei lysis buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 1% SDS) and then subjected to sonication 5 times for 30 seconds with 30 second intervals. Purified chromatin was analyzed on a 1% agarose gel to determine the shearing efficiency. As a control, normal IgG was used as a replacement for YAP or FoxO1 antibody (Santa Cruz Biotechnology). For sequential ChIP, sheared chromatin was first immunoprecipitated with FoxO1, followed by elution and a second immunoprecipitation using the YAP antibody. The ChIP procedure was performed as in the supplier’s protocol (Active Motif). ChIP-PCR primers: Catalase promoter-DBE1: forward: GGTGGACTATTGACAGTGT TGGG, reverse: CGCCATCCAGTTATTTACTCAGG; Catalase promoter-DBE2: forward: ACCAAATAAATAAGCAAAGTGAG, reverse: GAAACTCTAGAAGGGAC AGGATT; MnSOD promoter-DBE1: Forward: TCATGGCCACTATGCCTCAA, reverse: TCTCAGCTGTGTCCTCTTCC; MnSOD promoter-DBE2: forward: CCTCTTG TTTATTACATCAAGATTG, reverse: CTGGTTGTCAACTTGACTATATC.