To create the miR-29 target reporter plasmid, a synthetic DNA oligo with the sequence 5′- CTCGAGGAAGGTGCTA CCTCGAAATGCTGCAACCAAGGTGCTA GGTTGCCCGCAAGGTGCTA GCGGCCGC-3′ containing three miR-29 binding sites (Integrated DNA Technologies, Coralville, IA) was introduced downstream of the Renilla luciferase expression cassette (using XhoI and NotI restriction enzyme sites) in the psiCheck2 dual luciferase plasmid (Promega, Madison, WI). The pAAV2/5:U6-TuD-Ctrl (TuD-Ctrl, scrambled Tough Decoy control) construct was previously described.46 (link) pAAV2/5:U6-TuD-29 (TuD-29) shuttle plasmid was constructed by inserting DNA oligo sequences (Integrated DNA Technologies) to express the following TuD stem-loop sequence from the U6 promoter: GACGGCCTCGAGACTGGCAATAATTGATTCGCGATGGTGCTACAAGTATTCTGGTCACAGAATACCAATAATTGATTCGTGATGGTGCTACAACTAGTCTCGGGGCCGTCTT, cloned into a custom version of pFBAAVmU6mcsCMVeGFPSV40pA (ID G0347 University of Iowa Viral Vector Core [UIOWA VVC] Facility, Iowa City, IA).
Psicheck2 dual luciferase plasmid
Manufactured by Promega
The PsiCheck2 dual luciferase plasmid is a tool used in gene expression analysis. It contains two reporter genes, one for the firefly luciferase and one for the Renilla luciferase, which can be used to measure and compare the activity of different promoters or regulatory elements.
Automatically generated - may contain errors
2 protocols using psicheck2 dual luciferase plasmid
1
Plasmid Construction for miR-29 Regulation
2
Evaluating TRIM71 Binding to 3'UTR Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were co-transfected with the suitable psiCHECK2 dual luciferase plasmid (Promega) and the specified Flag-tagged TRIM71 variant construct in a 1:4 ratio. The psiCHECK2 plasmids contained a specific 3′UTR sequence downstream of the Renilla Luciferase ORF (either the CDKN1A 3′UTR Torres-Fernández et al., 2019 or an artificial 3′UTR with 8x Let-7 binding sites Torres-Fernández et al., 2021 (link)), while the Firefly Luciferase encoded in the same plasmid was used as a normalization control. Transfected cells were harvested 48 h post-transfection and Renilla and Firefly signals were measured consecutively with the use of a luminometer (MicroLumat Plus LB96V, Berthold) and the Dual Luciferase Reporter Assay Kit (Promega) according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!