Pilenti sirna gfp lentiviral vectors

Manufactured by Applied Biological Materials

Sourced in United States, Canada

PiLenti-siRNA-GFP lentiviral vectors are a tool for gene silencing and expression. They contain a green fluorescent protein (GFP) reporter and a short hairpin RNA (shRNA) sequence that can be used to knockdown target genes. The vectors are produced using lentiviral technology.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Profection kit, by Promega (1 mentions)

Close spelling variants of this product

PiLenti-siRNA-GFP Lentiviral vector

2 protocols using pilenti sirna gfp lentiviral vectors

Silencing HERC2 and SIRT1 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three sets of small interfering RNAs (RNAi) targeting human HERC2 (GCAACACAGTCGTGAAAGA; GCGGAAGCCTCATTAGAAA; and GAGCTGATTTCTTGAGTAA) or porcine HERC2 (GGACTTTCTGTGTCAAATA; CATTAAGACACATCAAGAA and GGAGGATTGCTCAGAAGAT) and two sets of RNAi (GGCACAGATCCTCGAACAA and CCAGTAGCACTAATTCCAA) targeting the conserved sequences of human and porcine SIRT1 were purchased from RiboBio (Guangzhou, China). The mixture containing 50 nM RNAi was used for transfection using Lipofectamine 2000 (Life Technologies, Grand Island, NY, USA).
Four sets of piLenti-siRNA-GFP lentiviral vectors targeting murine HERC2 were obtained from Applied Biological Materials Inc and tested in 3T3-L1 cell cultures (data not shown). The most effective siRNA (ACAGAGACTGTTACCTATTAAACCCTGCC) was packaged to produce the recombinant lentivirus (piLenti-HERC2siRNA-GFP) with a titer of 1.6 × 10⁸ IU/ml for subsequent administration to mice.

Bai B., Man A.W., Yang K., Guo Y., Xu C., Tse H.F., Han W., Bloksgaard M., De Mey J.G., Vanhoutte P.M., Xu A, & Wang Y. (2016). Endothelial SIRT1 prevents adverse arterial remodeling by facilitating HERC2-mediated degradation of acetylated LKB1. Oncotarget, 7(26), 39065-39081.

+ Open protocol

+ Expand

Lentiviral Production for siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviruses were produced from sets of four mouse piLenti-siRNA-GFP lentiviral vectors (Applied Biological Materials, Inc. Richmond, BC, Canada) targeting Pelp1 (cat no. i029598), Ncoa2 (cat no. i033105), Ncoa1 (cat no. i038883), Ncoa6 (cat no. i042804), Ncor1 (cat no. i044954), or Ncor2 (cat no. i042611), or the Control piLenti-siRNA-GFP lentiviral vector (cat no. LV015-G). HEK-293T cells in 3× 10 cm dishes per construct, were co-transfected with 10 μg lentiviral vector, 7.5 μg psPAX2, and 2.5 μg pVSV-G per dish using ProFection^® kit (Promega) according to manufacturer’s protocol. At ~15 h post-transfection, the media was replaced with 2.5 ml fresh media. Conditioned media containing lentiviral particles (LVM) were collected every 12 h for another 48 h, pooled, and stored at 4 °C. LVM were passed through a 0.45-micron filter to remove cell debris, and then centrifuged at 4,000 RPM overnight to pellet the viruses. The pellets were resuspended in 50 μl sterile PBS and added with 8 μg/ml polybrene to day-1 C2C12 myoblasts.

Bruno N.E., Nwachukwu J.C., Srinivasan S., Nettles C.C., Izard T., Jin Z., Nowak J., Cameron M.D., Boregowda S.V., Phinney D.G., Elemento O., Liu X., Ortlund E.A., Houtman R., Stavreva D.A., Hager G.L., Kamenecka T.M., Kojetin D.J, & Nettles K.W. (2021). Chemical Systems Biology Reveals Mechanisms of Glucocorticoid Receptor Signaling. Nature chemical biology, 17(3), 307-316.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!