The largest database of trusted experimental protocols

7 protocols using mttfa

1

STAT3 Knockdown and Mitochondrial Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For STAT3 knockdown using siRNA, following targeting ON-TARGETplus set of 4 SiRNA sequences (Dharmacon, USA) were used: 1. GAGAUUGACCAGCAGUAUA, 2. CAACAUGUCAUUUGCUGAA, 3. CCAACAACCCAAGAAUGU, 4. CAACAGAUUGCCUGCAUUG
The following primers were used to check mitochondrial DNA copy no: mtDNA, Forward primer: CCTCCTCCTAGCAGCAGC, Reverse primer: GGTTGTGGATGATGGACCCG; HPRT, Forward primer: CCTGGGGATTCCAAATACCT, Reverse primer: GGGCAGAAAAGGTCATCAAA.
The following antibodies were used for immunoblotting: S727STAT3, STAT3 (Cell signaling, USA), GAPDH, β-actin, and VDAC-1 (Santa-Cruz, Dallas, TX), Y705STAT3, OXPHOS cocktail antibody, mtTFA, PGC1α, NDUFA9, GRIM19 (Abcam, Cambridge, UK), CD44, CD24, CD133 (BD Bioscience), FLAG, HA (Sigma-Aldrich, USA)
+ Open protocol
+ Expand
2

Mitochondrial Protein Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The MFN1 (#ab57602), MFN2 (#ab56889), MT-TFA (#ab119684), IMMT (#ab110329), DNM1L (#ab56788), RCI subunit NDUFB8, 8KDa (#ab110242, #ab110245), and complex-IV subunit 2 (#ab110258) antibodies were procured from Abcam Inc., Cambridge, MA. β-Actin (#3700) was procured from Cell Signaling. The PINK1antibody (#LS-B3384), was procured from LSBioscience Inc., Seattle, WA. Anti-mouse (#115-035-003) and -rabbit (#111-035-003) secondary antibodies were obtained from Jackson ImmunoResearch, West Grove, PA.
+ Open protocol
+ Expand
3

Quantitative Fluorescence Imaging of Mitochondrial and Autophagy Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed with 4% PFA and stained with antibodies (Ab) against HO-1 (rabbit polyclonal Ab (pAb), 1:50, Enzo Life Sciences), LC3B (rabbit pAb, 1:500, Abcam), mtTFA (mouse monoclonal Ab, 1:100, Abcam) or human mitochondria (mouse mAb, 1:100, Abcam). Donkey secondary anti-rabbit or -mouse Ab (FITC- or Cy3-conjugated, 1:100) were purchased from Jackson ImmunoResearch Laboratories Inc. (Montlucon, France) Nuclei were stained with Hoechst 33342 (Sigma-Aldrich). Fluorescence was analyzed with a Zeiss Axioplan 2 Imaging microscope (Carl Zeiss, Marly le Roy, France). Measurement of fluorescence was calculated using ImageJ according to the formula ‘corrected total cell fluorescence=integrated density−(area of selected cell × mean fluorescence of background readings)’.
+ Open protocol
+ Expand
4

Melatonin's Mitochondrial Regulation Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Melatonin was obtained from Selleckchem (USA). D-Glucose was obtained from Sigma-Aldrich (St. Louis, MO, USA). NAC (N-acetyl-L-cysteine) was purchased from Beyotime Biotechnology (Shanghai, China). The primary antibodies against STAR, P450, AMPK, P-AMPK, COXIV, Cytc, NRF1, Beclin-1, ATG7, ATG12, ATG5 and LC3 were obtained from Cell Signaling Technology (Beverly, MA, USA); 3β-HSD, SIRT1, mtTFA, ATPB, PGC1-α and acetyl-Lysine were purchased from Abcam Biotechnology (Cambridge, MA, USA); BNIP3L, SOD2 and Tubulin 1-α were obtained from Beyotime Biotechnology (Shanghai, China); and LXR, GPX4, GPX5 and Actin were purchased from Proteintech Group (Wuhan, China). The goat anti-rabbit and goat anti-mouse secondary antibodies were purchased from Zhongshan Gold Bridge Biotechnology Co. Ltd. (Beijing, China). Alexa Fluor 488 donkey anti-mouse Immunoglobulin G (IgG) (H + L), MitoTracker™ Green FM and MitoSOX™ Red Mitochondrial Superoxide Indicator were obtained from Invitrogen (Carlsbad, CA, USA). The goat anti-mouse IgG/Alexa Fluor/594 were purchased from Zhongshan Gold Bridge Biotechnology Co. Ltd. (Beijing, China). Membrane and Cytosol Protein Extraction Kit, Cell Mitochondria Isolation Kit, Reactive Oxygen Species Assay Kit and Mitochondrial membrane potential assay kit with JC-1 were obtained from Beyotime Biotechnology (Shanghai, China).
+ Open protocol
+ Expand
5

Mitochondrial Proteome Profiling and Function

Check if the same lab product or an alternative is used in the 5 most similar protocols
For extraction of mitochondrial and cytosolic proteins, a commercially available kit from Sigma-Aldrich (#MITOISO2, Saint Louis, MO, USA) was used. For staining of mitochondria, MitoProbe™ JC-1 (5,5ʹ,6,6ʹ-tetrachloro-1,1ʹ,3,3ʹ-tetraethyl-imidacarbocyanine iodide) (#M34152, Molecular Probes, Invitrogen, CA) was used. A luciferase-based assay kit was purchased from Promega Corp. (#G7570, Madison, WI). Parkin (#ab77924), TOM20 (#ab186735), TIM23 (#ab230253), PGC-1α (#ab191838), mt-TFA (#ab131607), LC3 (#ab51520), P62 (#ab56416), P62 phospho S349 (#ab211324), COX IV (#ab202554), NLRP3 (#ab214185), ASC (#ab175449), caspase-1 (#ab179515), cleaved caspase-3 (#ab49822), IL-1β (#ab9722), KIM-1 (#ab47635), Bax (#ab32503), Bcl-2 (#ab182858) and GAPDH (#ab181602) antibodies were purchased from Abcam (Cambridge, UK). The CellTiter-Glo assay and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) staining kit were obtained from Keygen Biotech (#KGA7037, Nanjing, China). ELISA kits to assay inflammatory cytokines (tumour necrosis factor-α [TNF-α, #1217202], interleukin-1β [IL-1β, #1210122], and interleukin-6 [IL-6, #1210602]) were obtained from Dakewe Biotech (Shenzhen, Guangdong, China). The immunohistochemical kits were obtained from Beyotime (#P0203, Shanghai, China), and all the other chemicals were purchased from Sigma-Aldrich (Saint Louis, MO, USA).
+ Open protocol
+ Expand
6

Western Blotting Analysis of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting was performed using a standard protocol. We used the following primary and secondary antibodies: PCNA (1:1000; ab92552, Abcam, Cambridge, MA, USA), CYCLIN D1 (1:1000; #55506, Cell Signaling Technology, Danvers, MA, USA), phospho-CDK2 (p-CDK2; 1:1000; #2561, Cell Signaling Technology, Danvers, MA, USA), CDK2 (1:1000; #18048, Cell Signaling Technology, Danvers, MA, USA), SIRT1 (1:1000; #9475, Cell Signaling Technology, Danvers, MA, USA), PGC1α (1:1000; NAP1-04676, Novus Biologicals, Littleton, CO, USA), NRF1 (1:1000; #46743, Cell Signaling Technology), mtTFA (1:1000; ab131607, Abcam, Cambridge, MA, USA), ACTIN (1:2000; sc-8432, Santa Cruz Biotechnology, Dallas, TX, USA), ACTB (1:2000; A5316), HRP-conjugated anti-rabbit IgG (1:5000; #65-6120, Invitrogen, Carlsbad, CA, USA) and anti-IgG (1:5000; #62-6520, Invitrogen, Carlsbad, CA, USA). Bands were detected using a ChemiDoc XRD+ system (Bio-Rad, Hercules, CA, USA), and relative intensity was assessed using Image Lab software (Bio-Rad, Hercules, CA, USA).
+ Open protocol
+ Expand
7

Mitochondrial Dysfunction and Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
PD was supplied by Neptunus Co. (Shenzhen, Guangdong, China), and MitoProbe™ JC-1 (5,5′,6,6′-Tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide) was purchased from Molecular Probes (Invitrogen, CA). Mitochondriatargeted Keima plasmid (mt-Keima-COX8) was purchased from Public Protein/Plasmid Library (Nanjing, China). siRNA targeting Parkin and Atg7 were purchased from Santa Cruz Biotechnology. The terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) staining kit was supplied by Promega Corp. (Madison, WI). A mitochondrial/ cytosolic protein extraction kit was purchased from BestBio Co. (Beijing, China). Antibodies against Parkin, COX4I1, TOM20, TIM23, PGC-1α, mt-TFA, LC3I/LC3II, Bax, Bcl-2, cytochrome c and GAPDH were obtained from Abcam (Cambridge, UK). The Caspase-3 activity assay kit was obtained from Biovision (San Francisco, USA). Immunohistochemical kits were provided by EnVision™ (Dako, Copenhagen, Denmark). The fluorescein isothiocyanate (FITC) Annexin V apoptosis kit was obtained from BD Biosciences (San Jose, CA). Human lung epithelial cell lines (Beas-2B) were obtained from Guangzhou Cellcook Biotech Co., Ltd (Guangzhou, China). All other chemicals were acquired from Sigma-Aldrich (Saint Louis, MO, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!