Total RNA of samples was extracted using RNAiso Plus (TaKaRa, Japan) according to the manufacturer's instructions. The concentration and purity of all RNA samples were subsequently measured by NanoDrop2000 (Thermo Scientific, USA). 1 ug of total RNA was used for cDNA (Complementary DNA) synthesis using PrimeScript RTMaster Mix (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR) was performed on a QuantStudio Dx (ABI, America) using SYBR Premix ExTaq kit (Takara, Japan). The relative expression was calculated by the 2−△△Ct method with GAPDH reference control. All primer sequences were listed in Additional file 1 : Table S1.
Quantstudio dx
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The QuantStudio Dx is a real-time PCR (qPCR) system designed for nucleic acid detection and quantification. It features a thermal cycler, optical detection system, and software for data analysis. The QuantStudio Dx enables precise and reliable quantification of DNA, RNA, and other nucleic acid targets.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Primescript rt master mix, by Takara Bio (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq kit, by Takara Bio (3 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Buffer 3, by New England Biolabs (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Quantstudio real time pcr software, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Primestar, by Takara Bio (1 mentions)
Hieff unicon universal blue qpcr sybr green master mix, by Yeasen (1 mentions)
Hiscript 3 rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
Ultrapure rna kit, by CWBIO (1 mentions)
Ambion rna storage solution, by Thermo Fisher Scientific (1 mentions)
Magmax viral pathogen nucleic acid isolation kit, by Thermo Fisher Scientific (1 mentions)
M mlv rt, by Promega (1 mentions)
Taq pro universal sybr qrt pcr master mix, by Vazyme (1 mentions)
Mirvana kit, by Thermo Fisher Scientific (1 mentions)
24 protocols using quantstudio dx
1
Quantitative Real-Time PCR Gene Expression
2
Quantitative PCR protocol with PrimeSTAR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR system was carried out in a 20 μl reaction system in the 0.2 ml EP tube. Each reaction contains 10 μl of PrimeSTAR (TAKARA, Japan) PCR premix, 1 μl of forward primer (10 nM) and 1 μl of reverse primer (10 nM), 10 ng of sample DNA, and ddH2O to supplement the volume to 20 μl. The PCR reactions were processed for 35 cycles on an Eppendorf thermocycler with denaturation at 94°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 20 s. DNA electrophoresis was processed in 1% agarose gel in TAE buffer.
qPCR reactions were processed using Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (Yeasen, China) on QuantStudio Dx (ABI, US). Program started with a 95°C for 2 min followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 15 s qPCR. Each reaction was repeated in three biologically independent experiments.
qPCR reactions were processed using Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (Yeasen, China) on QuantStudio Dx (ABI, US). Program started with a 95°C for 2 min followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 15 s qPCR. Each reaction was repeated in three biologically independent experiments.
3
Quantifying Gene Expression Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA extraction was completed with RNAiso Plus (TaKaRa, Shiga, Japan). RNA quality and quantity were measured by NanoDrop2000 (Thermo Scientific, Wilmington, DE, USA). The RNA was reverse-transcribed into complementary DNA using PrimeScript RTMaster Mix (TaKaRa, Japan) according to the manufacturer’s instructions. Quantitative real-time PCRs (qRT-PCR) were performed on QuantStudio Dx (ABI, America) with SYBR Premix ExTaq kit (Takara, Shiga, Japan). The thermal cycler conditions were as follows: 30 s at 95.0 °C for cDNA denatured, followed by 40 cycles of 15 s at 95 °C and 60 °C for the 34 s. Verification of specific product amplification was performed by dissociation curve analysis. The mRNA relative expression was calculated by the 2^−ΔCt method with Gapdh used as an internal control [16 (link), 17 (link)].Primer sequences for each gene were listed in Supplementary Table 1 .
ROC analysis of the expression of candidate genes for assessing OR levels
| Gene | AUC | S.E. | Cut-off | Sensitivity (%) | Specificity (%) | P |
|---|---|---|---|---|---|---|
| Nobox | 0.915 | 0.060 | 0.00185771 | 96.3 | 80 | |
| Stk31 | 0.857 | 0.072 | 0.0002692 | 77.8 | 80 | |
| Sohlh1 | 0.993 | 0.010 | 0.00015527 | 92.6 | 100 | |
| Vrtn | 0.778 | 0.088 | 0.00034877 | 100 | 50 | |
| Padi6 | 0.811 | 0.083 | 0.0064735 | 96.3 | 60 | |
| Tbpl2 | 0.759 | 0.085 | 0.00028304 | 59.3 | 90 | |
| Lhx8 | 0.837 | 0.078 | 0.0009555 | 85.2 | 80 |
AUC, area under curve; S.E, standard error; P values < 0.05 are in bold
4
Quantitative LbCas12a Detection Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LbCas12a detection was carried out in Buffer 3.1 (NEB), 50nM lbCas12a protein, 60nM of crRNA and 30nM labeled probe, and 5µL PCR product, and ddH2O to supplement the volume to 20µL. The reaction system was mixed and then incubated at 37 °C. Reactions proceeded for one hour on QuantStudio Dx (ABI) with fluorescent kinetics measured every 2 min. Each reaction was repeated in three biologically independent experiments.
5
RNA Extraction and RT-qPCR Analysis of Cryptococcal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, the cryptococcal cells were harvested after 24-h incubation on V8 agar in the dark at 25℃. An Ultrapure RNA Kit (CW0581M, CWBIO) was used to extract the total RNA according to the manufacturer’s instructions. One microgram of the total RNA from each strain was treated with a commercial kit HiScript III RT SuperMix for qPCR (+gDNA wiper, R323-01, Vazyme) for DNA removal and reverse transcription according to the manufacturer’s instructions. The RT-qPCR analyses were performed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme) in an ABI RT-qPCR system (ABI QuantStudio Dx). All the primers used for RT-qPCR were listed in the Table S3 . Two biological replicates were performed for each sample, and the TEF1 gene was used as an endogenous control for the normalization of the relative transcript levels of the examined genes.
6
LbCas12a-based Nucleic Acid Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LbCas12a detection was carried out in a 20 μl system. The system contains 2 μl Buffer 3 (NEB, US), 50 nM LbCas12a protein, 60 nM crRNA, and 30 nM labeled probe, and 100 ng purified PCR product. Samples were mixed and then incubated at 37°C, and signals were obtained from QuantStudio Dx (ABI, US) every minute for 20–60 min. Each reaction was repeated in three biologically independent experiments.
For clinic detection, samples were incubated at 37°C for 20 min, and then photographed under the UV light exposure. Two independent experiments were processed for each sample.
For clinic detection, samples were incubated at 37°C for 20 min, and then photographed under the UV light exposure. Two independent experiments were processed for each sample.
7
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of the total RNA was completed with RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s instructions. RNA quality and quantity were measured by NanoDrop2000 (Thermo Scientific, Wilmington, DE, United States). Then RNA was reverse-transcribed into complementary DNA using PrimeScript RTMaster Mix (TaKaRa, Japan). Quantitative real-time PCRs (qRT-PCR) were performed on a QuantStudio Dx (ABI, America) using the SYBR Premix ExTaq kit (Takara, Shiga, Japan). The thermal cycler conditions were as follows: 30 s at 95.0°C for cDNA denatured, followed by 40 cycles of 15 s at 95°C and 60°C for the 30 s. Verification of specific product amplification was performed by dissociation curve analysis. The mRNA relative expression was calculated by the 2^-ΔΔCt method with Gapdh as an internal control (Livak and Schmittgen, 2001 (link)). The experiment was repeated in triplicate, and all primer sequences were listed in Table 2 .
8
SARS-CoV-2 E gene detection by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Conventional RT-PCR testing was performed by a Nebraska Medicine LDT for SARS-CoV-2 E gene detection adapted from Corman [11 ]; 600 nM and 800 nM concentrations of the forward and reverse primers, respectively, were used. RNA was extracted from 400 μL of sample using a KingFisher Flex automated extractor and the MagMAX Viral/Pathogen Nucleic Acid Isolation Kit (Applied Biosystems) and eluted in 50 μL. For all samples in which amplification of the E gene target was not detected, successful RNA extraction was confirmed by an identical PCR reaction using primers and probe specific for the cellular RNaseP gene that have been described by the Centers for Disease Control and Prevention [12 ]. The EDX SARS-CoV-2 RNA standard (Exact Diagnostics), which contains quantitated synthetic RNA transcripts comprised of five SARS-CoV-2 gene targets (E, N, ORF1ab, RdRp, and S) was diluted in Ambion RNA storage solution (ThermoFisher Scientific) to 5000, 2000, 1000, 500, 250, and 125 RNA copies/mL and extracted in triplicate. The QuantStudio Dx and QuantStudio Test Development Software version 1.0.3 (Applied Biosystems, Foster City, CA) were used for thermal cycling and data acquisition. A standard curve was generated to estimate the quantity of viral RNA in NP swab specimens based on LDT Ct values. Linear regression was performed in GraphPad Prism 8 (version 8.4.1).
9
Profiling Human Blood lncRNAs by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from human peripheral blood cells was extracted using the TRIzol Reagent. Reverse transcription was performed using random primers and M-MLV RT (Promega) following the manufacturer’s protocol. LncRNAs sequence information comes from the Ensemble database (https://grch37.ensembl.org/index.html ), using the national center for biotechnology information (NCBI) online tool to design primers and blasts.
The qRT-PCR reactions were executed using 2 × Taq Pro Universal SYBR qRT-PCR Master Mix (Vazyme) and carried out on a QuantStudio DX (Applied Biosystems Inc., Foster City, USA) according to the manufacturer’s protocol as follows: 95℃ for 30 s, followed by 40 cycles at 95℃ for 10 s, and at 60℃ for 30 s. The relative expression levels of lncRNAs were calculated using the 2−∆∆Ct method. The above primer sequences are listed in supplementary tableS1 .
The qRT-PCR reactions were executed using 2 × Taq Pro Universal SYBR qRT-PCR Master Mix (Vazyme) and carried out on a QuantStudio DX (Applied Biosystems Inc., Foster City, USA) according to the manufacturer’s protocol as follows: 95℃ for 30 s, followed by 40 cycles at 95℃ for 10 s, and at 60℃ for 30 s. The relative expression levels of lncRNAs were calculated using the 2−∆∆Ct method. The above primer sequences are listed in supplementary table
10
Quantifying miRNA expression in Regenerating Tails
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four 25 dpa regenerating tails were sectioned into five equal segments, and total RNA from each segment was extracted using the total RNA protocol for the miRVana kit (Ambion), as in Hutchins et al. [4 (link)]. cDNA for EF1A was synthesized using a poly-dT primer and SuperScript III (Thermo-Fisher), and was used for normalization. Taqman miRNA primers (Thermo-Fisher) were used to generate cDNA for each mature miRNA with single base resolution, using Taqman miRNA primers (Thermo-Fisher; Additional file 7 : Table S7). The first strand primers were pooled, and 100 ng of RNA was used to generate cDNA with SuperScript III. The qRT-PCR for EF1A was performed using SYBR Select Master Mix (Life Technologies) and custom primers (F: CCGTCGTTCTGGTAAGAAACTGG, R: TTAGCCTTCTGCGCCTTCTGG). The qRT-PCR for mature miRNAs was performed using Taqman Fast Advanced Master Mix (Applied Biosystems). Both the miRNA and EF1A qRT-PCRs were performed in 384 well plates on a QuantStudio Dx (Applied Biosystems). Each miRNA was assayed in triplicate for each tail section, totaling 600 qRT-PCR reactions. Relative expression levels were quantified by the ∆∆Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!