Conventional RT-PCR testing was performed by a Nebraska Medicine LDT for SARS-CoV-2 E gene detection adapted from Corman [11 ]; 600 nM and 800 nM concentrations of the forward and reverse primers, respectively, were used. RNA was extracted from 400 μL of sample using a KingFisher Flex automated extractor and the MagMAX Viral/Pathogen Nucleic Acid Isolation Kit (Applied Biosystems) and eluted in 50 μL. For all samples in which amplification of the E gene target was not detected, successful RNA extraction was confirmed by an identical PCR reaction using primers and probe specific for the cellular RNaseP gene that have been described by the Centers for Disease Control and Prevention [12 ]. The EDX SARS-CoV-2 RNA standard (Exact Diagnostics), which contains quantitated synthetic RNA transcripts comprised of five SARS-CoV-2 gene targets (E, N, ORF1ab, RdRp, and S) was diluted in Ambion RNA storage solution (ThermoFisher Scientific) to 5000, 2000, 1000, 500, 250, and 125 RNA copies/mL and extracted in triplicate. The QuantStudio Dx and QuantStudio Test Development Software version 1.0.3 (Applied Biosystems, Foster City, CA) were used for thermal cycling and data acquisition. A standard curve was generated to estimate the quantity of viral RNA in NP swab specimens based on LDT Ct values. Linear regression was performed in GraphPad Prism 8 (version 8.4.1).
Quantstudio dx
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The QuantStudio Dx is a real-time PCR (qPCR) system designed for nucleic acid detection and quantification. It features a thermal cycler, optical detection system, and software for data analysis. The QuantStudio Dx enables precise and reliable quantification of DNA, RNA, and other nucleic acid targets.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Quantstudio real time pcr software, by Thermo Fisher Scientific (2 mentions)
Magmax viral pathogen nucleic acid isolation kit, by Thermo Fisher Scientific (1 mentions)
Ambion rna storage solution, by Thermo Fisher Scientific (1 mentions)
M mlv rt, by Promega (1 mentions)
Taq pro universal sybr qrt pcr master mix, by Vazyme (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
Mirvana kit, by Thermo Fisher Scientific (1 mentions)
Sybr select master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Taqman mirna primers, by Thermo Fisher Scientific (1 mentions)
Mirna 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Magna pure lc total nucleic acid, by Roche (1 mentions)
Superscript 3 first strand kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Sybr green qpcr master mix, by Selleck Chemicals (1 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Premix ex taq kit, by Takara Bio (1 mentions)
17 protocols using quantstudio dx
1
SARS-CoV-2 E gene detection by RT-PCR
2
Profiling Human Blood lncRNAs by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from human peripheral blood cells was extracted using the TRIzol Reagent. Reverse transcription was performed using random primers and M-MLV RT (Promega) following the manufacturer’s protocol. LncRNAs sequence information comes from the Ensemble database (https://grch37.ensembl.org/index.html ), using the national center for biotechnology information (NCBI) online tool to design primers and blasts.
The qRT-PCR reactions were executed using 2 × Taq Pro Universal SYBR qRT-PCR Master Mix (Vazyme) and carried out on a QuantStudio DX (Applied Biosystems Inc., Foster City, USA) according to the manufacturer’s protocol as follows: 95℃ for 30 s, followed by 40 cycles at 95℃ for 10 s, and at 60℃ for 30 s. The relative expression levels of lncRNAs were calculated using the 2−∆∆Ct method. The above primer sequences are listed in supplementary tableS1 .
The qRT-PCR reactions were executed using 2 × Taq Pro Universal SYBR qRT-PCR Master Mix (Vazyme) and carried out on a QuantStudio DX (Applied Biosystems Inc., Foster City, USA) according to the manufacturer’s protocol as follows: 95℃ for 30 s, followed by 40 cycles at 95℃ for 10 s, and at 60℃ for 30 s. The relative expression levels of lncRNAs were calculated using the 2−∆∆Ct method. The above primer sequences are listed in supplementary table
3
Quantifying miRNA expression in Regenerating Tails
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four 25 dpa regenerating tails were sectioned into five equal segments, and total RNA from each segment was extracted using the total RNA protocol for the miRVana kit (Ambion), as in Hutchins et al. [4 (link)]. cDNA for EF1A was synthesized using a poly-dT primer and SuperScript III (Thermo-Fisher), and was used for normalization. Taqman miRNA primers (Thermo-Fisher) were used to generate cDNA for each mature miRNA with single base resolution, using Taqman miRNA primers (Thermo-Fisher; Additional file 7 : Table S7). The first strand primers were pooled, and 100 ng of RNA was used to generate cDNA with SuperScript III. The qRT-PCR for EF1A was performed using SYBR Select Master Mix (Life Technologies) and custom primers (F: CCGTCGTTCTGGTAAGAAACTGG, R: TTAGCCTTCTGCGCCTTCTGG). The qRT-PCR for mature miRNAs was performed using Taqman Fast Advanced Master Mix (Applied Biosystems). Both the miRNA and EF1A qRT-PCRs were performed in 384 well plates on a QuantStudio Dx (Applied Biosystems). Each miRNA was assayed in triplicate for each tail section, totaling 600 qRT-PCR reactions. Relative expression levels were quantified by the ∆∆Ct method.
4
Comprehensive RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent (Ambion) based on phenol/chloroform method. According to the manufacturer’s instructions, cDNA of mRNA-encoded genes was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). cDNA of miRNAs was synthesized using the miRNA-specific stem-loop reverse transcription primer and miRNA 1st Strand cDNA Synthesis Kit (Vazyme). SYBR Green qPCR was executed using TB Green Premix Ex Taq II (Takara Biotechnology). Primers were designed using Oligo7 software or obtained from GenBank, and they are listed in Supplemental Table 2 . Quantitative PCR was performed using a QuantStudio DX and the results were analyzed using QuantStudio Real-Time PCR software (Applied Biosystems).
5
SARS-CoV-2 N2 Gene RT-PCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A real time-PCR assay for SARS-CoV-2 RNA was performed in a CLIA certified high-complexity clinical laboratory using a laboratory developed test with emergency use authorization from the FDA. The assay contained a primer/probe set for amplification and detection of the N2 gene of SARS-CoV-2 multiplexed with a primer/probe set for amplification of human b-actin as an internal control. RNA extraction from clinical samples was performed using the Roche MagNA Pure LC Total Nucleic Acid automated extraction platform. RT-PCR was performed using the Applied Biosystems Quant Studio DX using TaqMan chemistry. In this method, if a target is present, an increase in fluorescence during thermocycling is detected due to DNA polymerase cleavage of a TaqMan probe when the probe is bound, separating reporter and quencher dyes. A test is positive if measured fluorescence crosses a defined threshold above background levels, and the cycle threshold (Ct) is the number of cycles required for this to occur. Generally, the greater the amount of target nucleic acid present in the sample, the lower the Ct. A Ct of 45 or lower for the SARS-CoV-2 N2 target was defined as a positive result.
6
Quantitative PCR Analysis of Neural Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the expression of neural markers, BDNF signaling genes, and HD-affected genes by quantitative PCR, neurons were harvested with TRIzol at desired time points for RNA isolation. Briefly, total mRNAs were extracted and reverse-transcribed into cDNAs using with the SuperScriptIII First-Strand kit (Life Technologies). Quantitative PCR was performed using TransStart Green qPCR SuperMix (TransGen Bio, China) and carried out on a 96-well QuantStudio Dx thermocycler (Applied Biosystems). All primers were verified by melting curve analysis with a single melt curve peak. Relative expression levels of each gene were analyzed using the 2−∆∆Ct algorithm, normalized to the expression levels of the housekeeping gene HPRT and relative to control samples. Primer sequences are listed in Table S1.
7
Quantifying mRNA Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Total RNA Extraction Kit was used to extract total RNA from CAL-148 and MCF-7 cells. Afterward, a total RNA sample was reverse-transcribed into cDNA following the manufacturer’s instructions for the MonScript™ RTIII Super Mix with dsDNase (two steps). Ultimately, for measuring the expression level of mRNA, qRT-PCR was performed using 2 × SYBR Green qPCR Master Mix in QuantStudio Dx (Applied Biosystems, CA, USA). The primer pairs used are listed in Table 2 . β-Actin was used as a control gene, and the amount of RNA was computed using the 2-ΔΔCt method.
8
Quantitative Real-Time PCR Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol Reagent (Ambion, Austin, TX, USA) based on phenol/chloroform method. cDNA of mRNA-encoded genes were synthesized using the RevertAid First Strand cDNA Synthesis Kit (ThermoScientific, Lithuania). SYBR Green qPCR were executed using TB Green® Premix Ex Taq™ II (Takara Biotechnology, Dalian, China). Primers were designed using Oligo7 software or obtained from GenBank, and these are listed in Supplementary Table 1
9
Quantitative Analysis of Cardiomyocyte Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from H9C2 cardiomyocytes using RNA Simple Total RNA kit (Tiangen, China). The complementary DNA (cDNA) was synthesized from 500 ng of total RNA using PrimeScript RT Master Mix (Takara, Japan). Quantitative PCR was performed using SYBR Green qPCR Master Mix (Bimake, China) on Applied Biosystems Quantstudio Dx (Thermo Fisher, USA). The expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference and the relative expression of target genes was calculated by the 2-ΔΔCt method. The following primer sequences were used: GAPDH forward: 5′ GTGCTGAGTATGTCGTGGAGTC 3′, reverse: 5′ TTGCTGACAATCTTGAGGGA 3′; CH25H forward: 5′ AATACATGAGCGTCTGGGAGC 3′, reverse: 5′ CCACGGAAAGTCGTAACCTG 3′; NLRP3 forward: 5′ TGACGCTCTGTGAGGTTCTG 3′; reverse: 5′ TCAGCTCAGGCTTTTCCTCC 3′; Caspase-1 forward: 5′ CGGGCAAGCCAGATGTTTAT 3′; reverse: 5′ AATGCGCCACCTTCTTTGTT 3′; GSDMD forward: 5′ TCCAGTGCCTCCATGAATGT 3′; reverse: 5′ GTGATCTGCACCTCCTCCTT 3′; IL-1β forward: 5′ AGGCTGACAGACCCCAAAAG 3′; reverse: 5′ CTCCACGGGCAAGACATAGG 3′.
10
SARS-CoV-2 RNA Detection in Environmental Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The environmental sample detection methods included nucleic acid extraction (NP968, Tianlong Science & Technology, Xi'an, China) and amplification by real-time quantitative reverse-transcription (RT)-PCR (Applied Biosystems QuantStudio Dx, Thermo Fisher Scientific, Waltham, MA, USA). Detection of SARS-CoV-2 RNA was performed using a real-time RT-PCR kit from Shanghai Chromysky Medical Research Co. Ltd. (Shanghai, China). Each sample for RT-PCR was run in duplicate according to the manufacturer's instructions. The patients' samples were analyzed by The Second Hospital of Nanjing using an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The nucleic acid detection reagents were obtained from Huada Biotechnology (Wuhan) Co., Ltd. A sample was defined as positive at a Ct ≤38, and weakly positive at a Ct of 37–38. A standard curve generated from the RNA standards was previously published by this institution for validation of the RT-PCR method used to quantify SARS-CoV-2 (Shi et al., 2020 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!