Riboex

DVL3 RNA level was measured by quantitative reverse transcription polymerase chain reaction (qRT‐PCR). Total RNA was extracted using RiboEX (Geneall biotechnology, Seoul, Korea) from hippocampus tissue and cDNA was synthesized using High‐Capacity cDNA Reverse Transcription kit (Thermo Scientific). Quantitative real‐time PCR was performed on a 7500 real‐time PCR system (Applied Biosystems) for custom‐designed primers and β‐actin was used for house‐keeping control using HiPi Real‐Time PCR SYBR green master mix (ELPIS biotech). Cycling conditions consisted of initial denaturation step of 3 min at 94°C, a denaturation step of 30 s at 94°C, an annealing step of 30 s at 60°C, and extension step of a minute at 72°C followed by 40 cycles. The values obtained for the target gene expression were normalized to β‐actin and quantified relative to the expression in control samples.
Each sample was run with the following primer pairs:

β‐actin, Forward primer: 5′‐ GGCTGTATTCCCCTCCATCG‐3′, Reverse primer: 5′‐ CCAGTTGGTAACAATGCCATGT‐3′;

DVL3, Forward primer: 5′‐ GTCACCTTGGCGGACTTTAAG‐3′, Reverse primer: 5′‐ CCAAAATCGTCGTCCATAGACTT‐3′;

Along with qRT‐PCR, enzyme‐linked immune‐sorbent assay (ELISA) was used to measure DVL3 RNA level. Lysates of brain tissue were obtained through a protein extraction buffer containing protease inhibitor.

Total RNA from each sample was isolated using RiboEx™ (GeneAll, Seoul, Korea), and cDNAs were synthesized with oligo-dT and M-MLV reverse transcriptase (Enzynomics, Daejeon, Korea). According to the manufacturer's instructions, qRT-PCR was performed with Qiagen Rotor-Gene Q Real-time PCR Detection System using QuantiNova™ SYBR Green PCR kit (Qiagen GmbH, Düsseldorf, Germany). The primers used in this study were as follows: LIF, forward 5′-GGCCCGGACACCCATAGACG-3′ and reverse 5′-CCACGCGCCATCCAGGTAAA-3′; ITGAV, forward 5′-ATGCTCCATGTAGATCACAAGAT-3′ and reverse 5′-TTCCCAAAGTCCTTGCTGCT-3′; ITGB3, forward 5′-CTGCCGTGACGAGATTGAGT-3′ and reverse 5′-TGCCCCGGTACGTGATATTG-3′; ITGB5, forward 5′-ACCTGGAACAACGGTGGAGA-3′ and reverse 5′-AAAAGATGCCGTGTCCCCAA-3′; and β-actin, forward 5′-CAAGAGATGGCCACGGCTGCT-3′ and reverse 5′-TCCTTCTGCATCCTGTCGGCA-3′.

Total RNA was extracted using RiboEX (GeneAll, Seoul, Republic of Korea). cDNA was synthesized using a GoScript™ Reverse Transcript kit (Promega, WI, USA), according to the manufacturer’s instructions. SYBR Green PCR Mixture (Toyobo, NY, USA) was used for qRT-PCR analysis. Expression data were acquired using a StepOnePlus™ Real-Time PCR System (Applied Biosystems, CA, USA). Expression levels of each target were calculated using the 2^−ΔΔCt method and were presented as relative mRNA expression. The sequences of primers used for qRT-PCR were previously described [37 (link)].

Cells were homogenized in RiBoEx (Geneall Biotechnology Co., Ltd., Seoul, Korea). Cell lysates were mixed with 200 ul chloroform and centrifuged at 12,000× g for 15 min at 4 °C. Total RNA was determined by performing phase separation, binding, washing, and elution using the Hybrid-R™ kit (Geneall Biotechnology Co. Ltd. Seoul, Republic of Korea) as per the manufacturer’s instructions. Subsequently, primer Script TM RT Reagent Kit with Genomic DNA (gDNA) Eraser (TAKARA Bio Inc. Shiga, Japan) was used for complementary DNA (cDNA) reverse transcription. RT-qPCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The cycling conditions were as follows: enzyme activation for 1 min at 95 °C, denaturation for 15 s at 95 °C, and annealing for 15 s at 60 °C. qRT-PCR was performed for at least 45 cycles. The targeted mRNA expression genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (Actin, internal control) expression and were calculated using the 2^−ΔΔCt method. The specific primer sequences are listed in Table 2.

Total RNA was isolated from primary RA-FLSs cultured in a transwell system using Ribo^Ex (GeneAll, Songpa, Gyeongsan, Republic of Korea). Ribo^Ex was added to RA-FLSs, and the cells were broken via sonication. Following the addition of chloroform, the sample was centrifuged at 12,000× g for 15 min at 4 °C. The supernatant was placed in a new tube, isopropanol was added to the tube, and the mixture was incubated on ice for 10 min. The mixture was centrifuged at 12,000× g for 10 min at 4 °C. Thereafter, the supernatant was removed and washed with 70% ethanol. After centrifugation at 7500× g for 10 min at 4 °C, the supernatant was removed and dried in air to dissolve the pellets in DEPC-treated water. RNA was quantified using a Spectrophotometer ND-1000 (Thermo Fisher, Waltham, MA, USA) and then amplified using a cDNA synthesis kit from Enzynomics (Daejeon, Republic of Korea), according to the manufacturer’s instructions. RT-qPCR was performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Waltham, MA, USA), primers, and the QuantStudio 3 RT-PCR system (Applied Biosystems). The primers used in this study are listed in Table 1. The following RT-qPCR cycling protocol was employed: UDG activation at 50 °C for 2 min, Dual-Lock DNA polymerase at 95 °C for 2 min, denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, and extension at 72 °C for 1 min.

Total RNA from cells was extracted using a RiboEx (Geneall, Korea) and a Qiagen RNA isolation kit (Qiagen, Valencia, CA, USA) according to manufacturer's instruction. The total RNA concentration was measured by Nanodrop spectrometer (Thermoscientific). Generation of first strand cDNA from total RNA and amplification of this cDNA strand were reacted together using Primer ScriptTM one step RT-PCR kit Ver2 (TAKRA, Japan) and PCR machine (Bio-rad, Richmond, CA, USA) according to manufacturer's instructions. Differently expressed mRNA was separated by 1.2 % agarose gel electrophoresis. Specific primer sequences are as follows:
MMP-1 fwd, 5′-GATGGGAGGCAAGTTGAAA A-3′; MMP-1 rev, 5′-CTGGTTGAAAAGCATGAGCA-3′; CXCL1 fwd, 5′-GAAAGCTTGCCTCAATCCTG-3′; CXCL1 rev, 5′-CCCTGCCTTCACAATGATCT-3′; PTGS2 fwd, 5′-TGCTGTGGAGCTGTATCCTG-3′; PTGS2 rev, 5′-GACTCCTTTCTCCGCAACAG-3′;
TNC fwd, 5′-GTCACCGTGTCAACCTGATG-3′; TNC rev,5′-TCCCAGAGCCACCTAAGAGA-3′;
ACTB fwd, 5′-GCTCGTCGTCGACAACGGCTC-3′; ACTB rev, 5′-CAAACATGATCTGGGTCATCTTCTC-3′.

The mRNA level was assessed by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA from hippocampus tissue was extracted using RiboEX (Geneall Biotechnology, Seoul, Republic of Korea). cDNA was synthesized using a High-Capacity cDNA Reverse Transcription kit (Thermo Scientific, Waltham, MA, USA). qRT-PCR was performed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA) using HiPi Real-Time PCR SYBR green master mix (ELPIS biotech, Daejeon, Republic of Korea) with custom-designed primers. As a housekeeping control, β-actin was used. A total of 40 cycles were performed, consisting of an initial denaturation step of 3 min at 94 °C, a denaturation step of 30 s at 94 °C, an annealing step of 30 s at 56 °C, and an extension step of 1 min at 72 °C. The mRNA levels of target genes were normalized to β-actin. The primer pairs we used are shown in the Supplementary Material (Supplementary Table S1).