Log In Sign up
The largest database of trusted experimental protocols

Rapid dna ligation kit

Manufactured by Roche
Visit Supplier
Sourced in Switzerland, United States

The Rapid DNA Ligation Kit is a laboratory tool designed for the efficient ligation of DNA fragments. It facilitates the joining of DNA segments by catalyzing the formation of phosphodiester bonds between the 3' hydroxyl and 5' phosphate ends of the DNA, enabling the assembly of recombinant DNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Restriction enzyme, by New England Biolabs (3 mentions) Pgl3 basic vector, by Promega (3 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Minelute pcr purification kit, by Qiagen (2 mentions) Rapamycin, by Merck Group (2 mentions) Pcr clean up and gel purification kit, by Macherey-Nagel (2 mentions) Stellar competent cells e coli hst08, by Takara Bio (2 mentions) In fusion hd cloning kit, by Takara Bio (2 mentions) Pcdna5 frt to vector, by Thermo Fisher Scientific (2 mentions) Kod plus mutagenesis kit, by Toyobo (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Qiaprep miniprep kit, by Qiagen (1 mentions) Maxiprep kit, by Qiagen (1 mentions) Ivis spectrum, by PerkinElmer (1 mentions) Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions) Ex taq dna polymerase, by Takara Bio (1 mentions) Pgem t easy vector, by Promega (1 mentions) Pfu polymerase, by Promega (1 mentions) Ecori restriction enzyme, by New England Biolabs (1 mentions) Ncoi restriction enzyme, by New England Biolabs (1 mentions)

51 protocols using rapid dna ligation kit

1

Construction and Validation of DR5-Luc Reporter Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pGL3-DR5 plasmid was a gift from Dr. Hong-Gang Wang (Penn State, Hershey, PA; ref. 16 (link)). This plasmid contained a DR5 5’ flanking sequence (−552 to −7) with a CHOP binding region and mutant NF-kB region (Supplementary Fig. S1). The DR5 5’ flanking sequence was subcloned into the pGL4.21 plasmid (Promega) upstream of the luciferase reporter using a Rapid DNA Ligation Kit (Roche). DH5α containing the DR5-Luc plasmid were expanded under ampicillin selection followed by DNA extraction using QIAprep Miniprep Kit (Qiagen). Insertion of the DR5 sequence was confirmed using an E-Gel following restriction digestion with Sac1 and Xho1. Selected clones were expanded in LB Broth under ampicillin selection followed by DNA extraction using a Qiagen Maxi Prep Kit. U251 cells were transfected with the DR5-Luc plasmid using Lipofectamine 2000 (Invitrogen), and grown under puromycin (2 μg/mL) selection. Single clones were selected and expanded using DMEM supplemented with Puromycin (1 μg/mL). U251 DR5-Luc clones were probed for luciferase expression following Nelfinavir treatment, leading to identification of a single positive clone. Dose-dependent expression of DR5 and Luciferase in this clone was confirmed via Western Blot analysis and bio-luminescent imaging (IVIS Spectrum; PerkinElmer).
Sheikh S., Saxena D., Tian X., Amirshaghaghi A., Tsourkas A., Brem S, & Dorsey J.F. (2019). An Integrated Stress Response Agent that Modulates DR5-Dependent TRAIL Synergy Reduces Patient-Derived Glioma Stem Cell Viability. Molecular cancer research : MCR, 17(5), 1102-1114.
+ Open protocol
+ Expand
2

Cloning Genes into pBAD28 Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
All plasmids and primers used in this study are listed in Supplementary Tables S1–S3, respectively. Genes of interest were amplified by PCR, the PCR products digested with indicated restriction enzymes and ligated into the pBAD28 vector using the Rapid DNA Ligation Kit (Roche Diagnostics). Inserted DNA sequences were confirmed by DNA sequencing (StarSeq).
Li F., Cao L., Bähre H., Kim S.K., Schroeder K., Jonas K., Koonce K., Mekonnen S.A., Mohanty S., Bai F., Brauner A., Lee V.T., Rohde M, & Römling U. (2022). Patatin-like phospholipase CapV in Escherichia coli - morphological and physiological effects of one amino acid substitution. NPJ Biofilms and Microbiomes, 8, 39.
+ Open protocol
+ Expand
3

cDNA Synthesis and CLCN1 Minigene Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
For cDNA synthesis, 1.0 µg of total RNA was reverse-transcribed with a PrimeScript 1st Strand cDNA synthesis Kit (TaKaRa Bio) in a total volume of 10 µL using oligo(dT) primers. cDNA samples were then diluted fivefold prior to use. PCR was performed using Ex Taq DNA polymerase (TaKaRa Bio) according to the manufacturer's protocol. For sequence analysis of the CLCN1 (5–7) minigene, PCR was carried out using the following primer set: forward (5′-CATGGTCCTGCTGGAGTTCGTG-3′) and reverse (5′-CTCCAAGTGGTGTCCCAAAACAAC-3′). PCR conditions were as follows: an initial denaturation step at 96 °C for 2 min, 30 cycles at 96 °C for 30 s, 62 °C for 30 s and 72 °C for 30 s, and a final extension step of 72 °C for 5 min. PCR products were then separated via 8% polyacrylamide gel electrophoresis and soaked in ethidium bromide solution (1 µg/ml); then the relevant bands were extracted from the gel. The spliced gel was shaken in solution buffer (0.5 M ammonium acetate and 1 mM EDTA in sterilised water) for 48 h, after which the products were washed in isopropyl alcohol followed by ethanol precipitation. Precipitates were then dissolved in a volume of 5 µL sterilised water. The purified DNA fragment was inserted into a pGEM-TEasy vector (Promega) using a Rapid DNA Ligation Kit (Roche) and sequenced to confirm proper insertion.
Nakamura T., Ohsawa-Yoshida N., Zhao Y., Koebis M., Oana K., Mitsuhashi H, & Ishiura S. (2015). Splicing of human chloride channel 1. Biochemistry and Biophysics Reports, 5, 63-69.
+ Open protocol
+ Expand
4

Cloning of NBD and TMD Transporters

Check if the same lab product or an alternative is used in the 5 most similar protocols
First, the genes encoding the NBD (spd_0804) and the TMD (spd_0805) of the transporter were PCR-amplified from S. pneumoniae D39 genome by using the Pfu-polymerase (Promega) and the primers BceA-1 and BceB-1. A second PCR was performed using the primers BceA-2 and BceB-2 to enable the insertion of a polyhistidine tag on the N-terminus of the NBD and the C-terminus of the TMD respectively, using the first PCR fragment as a template. The pRSF-Duet1 plasmid and the second his-NBD-TMD-his fragment were both sequentially digested by first NcoI restriction enzyme (New-England Biolabs) and by EcoRI restriction enzyme (New-England Biolabs) according to the manufacturer’s instructions. Next, the fragment and the plasmid were ligated using Rapid DNA ligation kit (Roche). The ligation reaction was used to transform XL10Gold competent bacteria (Invitrogen). Positive clones were selected by restriction digest and verified by sequencing.
Diagne A.M., Pelletier A., Durmort C., Faure A., Kanonenberg K., Freton C., Page A., Delolme F., Vorac J., Vallet S., Bellard L., Vivès C., Fieschi F., Vernet T., Rousselle P., Guiral S., Grangeasse C., Jault J.M, & Orelle C. (2022). Identification of a two-component regulatory system involved in antimicrobial peptide resistance in Streptococcus pneumoniae. PLoS Pathogens, 18(4), e1010458.
+ Open protocol
+ Expand
5

Genomic DNA Isolation from Bacterial Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA (gDNA) from P. luminescens TT01 and S. coelicolor M145 was isolated from cultures grown to an OD600 of 1 and OD450 of 0.8, respectively, using a standard phenol chloroform DNA purification protocol and validated using routine PCR amplification. All primers used in this study are detailed in S4 Table. All vectors used in this study are listed in S5 Table. CloneAmp HiFi PCR Premix (TaKaRa, Kusatsu, Japan) was used for all routine PCR amplification; for PCR products over 10 Kb PrimeSTAR Max DNA polymerase (TaKaRa, Kusatsu, Japan) was used. All PCR products and restriction endonuclease (RE) digests were purified using the MinElute PCR purification kit (Qiagen, Hilden, Germany) as per manufacturer instructions. All ligations were performed using the Rapid DNA ligation kit (Roche, Basel, Switzerland) as described by the manufacturer. All REs used in this study were obtained from New England Biolabs (NEB; Ipswich, MA), and digests were performed for 1 h at 37°C unless stated otherwise.
Cummings M., Peters A.D., Whitehead G.F., Menon B.R., Micklefield J., Webb S.J, & Takano E. (2019). Assembling a plug-and-play production line for combinatorial biosynthesis of aromatic polyketides in Escherichia coli. PLoS Biology, 17(7), e3000347.
+ Open protocol
+ Expand
6

Viral Genome Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Restriction enzymes were ordered from New England Biolabs (Ipswich, MA). Rapid DNA ligation kit was from Roche Diagnostics (Indianapolis, IN). Primers for PCR and sequencing were designed with the help of Primer3 online software, and primers were ordered from Integrated DNA Technologies (Coralville, IA). The primers for sequencing are listed in Table 2.

Primers Used for DNA Sequencing

Sequences (5′–3′)
LP12CGCATTTTCTAACGTGATGG
RP1427AACACTTTCTACACACCGATTGA
LP84GAACGGCGGACATATTCAGT
RP1372GGTTTCCTCACCCAATCGTT
LP84GAACGGCGGACATATTCAGT
LP469CCCCCTGAACCTGAAACATA
LP659CTCAAGTGATCCACCCACCT
LP939ACACACTTGGCGGTTCTTTC
LP1220ATAGTAGCCGCACTCGATGG
RP271TTGCTTCCAATGCTTCAAAA
RP678AGGTGGGTGGATCACTTGAG
RP813GAGGCTTCCCCTCACTATCC
RP1134CGCTGTCATCCTCATTGCTA
RP1204GTTTGCCATACGCTCACAG
LP-A34R121GAACTGATGCCTAGTGCTTG
RP-A35R875CCATTGCCGTCTGATATGC
LP-A34R399CAGTACGACGGATGCTGAAG
Viral genomic DNA was purified using a DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA) according to manufacturer’s instructions. PCR was conducted with 30 ng viral genomic DNA, Taq 2x Master Mix (New England Biolabs), through 35 cycle of amplification. PCR products were purified using High Pure PCR Product Purification Kit (Roche Diagnostics). DNA sequencing was performed by the University of Pittsburgh Genomics Research Core Facility.
Guo Z.S., Liu Z., Sathaiah M., Wang J., Ravindranathan R., Kim E., Huang S., Kenniston T.W., Bell J.C., Zeh HJ I.I.I., Butterfield L.H., Gambotto A, & Bartlett D.L. (2017). Rapid Generation of Multiple Loci-Engineered Marker-free Poxvirus and Characterization of a Clinical-Grade Oncolytic Vaccinia Virus. Molecular Therapy. Methods & Clinical Development, 7, 112-122.
+ Open protocol
+ Expand
7

Cloning and Characterization of CD44 and HAS2 Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human CD44 shRNA that targets all CD44 isoforms and control
luciferase shRNA were obtained from S. Godar, University of Cincinnati,
Cincinnati, Ohio. Human CD44s and CD44v3-10 cDNA sequences were cloned into the
EcoRI restriction site of pBabe-hygro vector. The HAS2 promoter region was
PCR-amplified from genomic DNA isolated from human MDA-MB-231 cells (Qiagen
Blood & Cell Culture Mini Kit). The HAS2 1.2-kb promoter region chosen
for PCR amplification was based on a previously published study (27 (link)). PCR product was purified and digested with SacI
and BgIII and cloned into the pGL3 luciferase vector. Ligation was carried out
using the Roche Rapid DNA Ligation Kit according to the manufacturer's
instructions. Sequences of primers used for HAS2 promoter cloning are as
follows: Forward: 5′-CGCAATCTCCCAAGACCAAGTT-3′; Reverse:
5′-GAATTACCCAGTCCTGGCTTCG-3′. Expression plasmids
pcDNA3-HA-myristoylated-Akt1, pcDNA3-Flag-FKHR (FOXO1), pECE-FLAG-FOXO3a, and
pBR322-SV40-FLAG-FOXO4 were obtained from Addgene. pLX304 empty and pLX304-HAS2
(clone: HsCD00443505) plasmids were obtained from DNASU Plasmid Repository. The
HAS2 shRNA–expressing plasmid (targeting sequence
5′-AATCCAGTGATAATCGCTTCG-3′) was kindly provided by Dr.
Kounosuke Watabe at the Wake Forest School of Medicine, Winston-Salem, NC.
Liu S, & Cheng C. (2017). Akt Signaling Is Sustained by a CD44 Splice Isoform–Mediated Positive Feedback Loop. Cancer research, 77(14), 3791-3801.
+ Open protocol
+ Expand
8

Antifolate, Rapamycin, and PKG Inhibitor Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The antifolate drug WR99210 was from Jacobus Pharmaceuticals. Rapamycin was from Sigma-Aldrich and used to treat parasites at 20 nM. The PKG inhibitor (4-[7-[(dimethylamino)methyl]-2-(4-fluorphenyl)imidazo[1,2-α]pyridine-3-yl]pyrimidin-2-amine) (compound 2) was stored at −20°C as a 10 mM solution in DMSO and used in cultures at 1 μM. For PKG detection, a rabbit polyclonal human-PKG antibody (Enzo) was used at a dilution of 1:1,000. The GFP-specific mAb 11814460001 (Roche) was used at a dilution of 1:1,000, as was a polyclonal rabbit anti-mCherry (ab167453; Abcam). A polyclonal rabbit anti-SERA5 antibody was used at 1:2,000 (80 (link)). The anti-HSP70 antibody (used at 1:1,000) was a kind gift of Dr Ellen Knuepfer, Francis Crick Institute. Restriction enzymes were from New England BioLabs and DNA ligations were performed with the Rapid DNA ligation kit (Roche).
Koussis K., Withers-Martinez C., Baker D.A, & Blackman M.J. (2020). Simultaneous multiple allelic replacement in the malaria parasite enables dissection of PKG function. Life Science Alliance, 3(4), e201900626.
+ Open protocol
+ Expand
9

Recombinant Expression of ACP Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
ACP DNA sequences flanked with NdeI/EcoRI or NdeI/BamHI restriction sites were ordered as gBlock DNA fragments from Integrated DNA Technologies (IDT) for insertion into a pET28a vector for expression of the encoded ACPs with an N-terminal His6-tag. The gBlock DNA was digested with the appropriate restriction enzymes, gel-purified, and cloned into the corresponding sites of pre-digested pET28a vector using the Roche Rapid DNA Ligation kit. Mutagenic PCR was used to obtain Ec-ACP mutant plasmids. See Supporting Information for details.
Rivas M., Courouble V.C., Baker M.C., Cookmeyer D.L., Fiore K.E., Frost A.J., Godbe K.N., Jordan M.R., Krasnow E.N., Mollo A., Ridings S.T., Sawada K., Shroff K.D., Studnitzer B., Thiele G.A., Sisto A.C., Nawaal S., Huff A.R., Fairman R., Johnson K.A., Beld J., Kokona B, & Charkoudian L.K. (2018). The Effect of Divalent Cations on the Thermostability of Type II Polyketide Synthase Acyl Carrier Proteins. AIChE journal. American Institute of Chemical Engineers, 64(12), 4308-4318.
+ Open protocol
+ Expand
10

Construction of pattb-QF2-hsp70 Plasmid

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The pattb-QF-hsp70 plasmid3 (link) and pattb-syb-QF2 were both cut with EcoRI and ZraI, and the isolated QF2 insert was ligated into the digested pattb-hsp70 vector using the Rapid DNA Ligation Kit (Roche). The pattb-QF2-hsp70 plasmid was digested with EcoRI and BamHI, the DSCP promoter PCR-amplified from pattB-DSCP-QF-SV403 (link) with forward primer IF_FOR_DSCP_QF2 and reverse primer IF_REV_DSCP_QF2, cloned into the digest vector by an In-Fusion reaction. This PhiC31 integrase compatible plasmid utilizes the DSCP promoter27 (link) to allow for the cloning of enhancer regions to drive QF2 expression.
Riabinina O., Luginbuhl D., Marr E., Liu S., Wu M.N., Luo L, & Potter C.J. (2015). Improved and expanded Q-system reagents for genetic manipulations. Nature methods, 12(3), 219-222.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!