M mlv kit

Manufactured by Promega

Sourced in United States, Germany, China

The M-MLV kit is a reagent system designed for reverse transcription of RNA into cDNA. It contains M-MLV Reverse Transcriptase, an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from an RNA template.

Automatically generated - may contain errors

Lab products found in correlation

97 protocols using m mlv kit

Profiling Circular RNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using Trizol (Ambion, Austin, TX, USA) as per the manufacturer’s instructions. RNA was reverted into complementary DNA (cDNA) using the Promega M-MLV kit. qPCR was carried out with the help of SYBR Select Master Mix (Applied Biosystems, Inc., Foster City, CA, USA) on the Applied Biosystems 7500 Fast platform (Applied Biosystems). After normalization with reference to GAPDH expression, the relative expression was calculated as 2^−ΔΔCT method. Primer sequences are listed in Table 1.Table 1

Primers

Targets	Forward (5ʹ-3ʹ)	Reverse (5ʹ-3ʹ)
Circ_0000629	CAGTTGATGTCCTCTGCCAGTG	AGAGCACCTCTGTGGCATTCTC
CDC73	GAGAGAGTATGGAGGACACGAAC	ATTTGGGGCAGGTCGCTGTTCA
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA
miR-1290	TGGATTTTTGGATCAGGG	GAACATGTCTGCGTATCTC
U6	CTCGCTTCGGCAGCACAT	TTTGCGTGTCATCCTTGCG

Abbreviations: circRNA, circular RNA; miRNA, microRNA; CDC73, cell division cycle 73.

Wang J., Luo J., Wu X, & Gao Z. (2021). Circular RNA_0000629 Suppresses Bladder Cancer Progression Mediating MicroRNA-1290/CDC73. Cancer Management and Research, 13, 2701-2715.

+ Open protocol

+ Expand

Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol® reagent (Shanghai Pufei Biotech Co., Ltd.) based on the supplier's instruction. M-MLV kit (Promega Biotech Co., Ltd) was used to obtained cDNA by reverse transcription. qPCR was conducted using the SYBr Master Mix (Takara Biomedical Technology Co., Ltd.) and the Real‐Time PCR System (LightCycler 480 II) in the 12 μl reaction mixture with the following conditions: initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec, then followed by one cycle of 95°C for 15 sec, 60°C for 30 sec, and 95°C for 15 sec. The following primer information was used for qPCR: ACTB forward, 5′-GCGTGACATTAAGGAGAAGC-3′ and reverse, 5′-CCACGTCACACTTCATGATGG-3′; RP11-617F23.1 forward, 5′-ACCGCAGGCACTTGTGAAGA-3′ and reverse, 5′-AAGGGACATGCAGAGGGGAG-3′. For quantification of RNA levels, the ΔΔCT method was applied, and the internal reference gene ACTB was used for normalization.

Ding W., Sun P., Tan Y., Jiang H., Xi C., Zhuang L., Xu Y, & Xu X. (2022). Construction of a Prognostic Immune-Related LncRNA Risk Model for Gastric Cancer. Journal of Oncology, 2022, 5137627.

+ Open protocol

+ Expand

Quantifying TGFA and miR-376c Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

When the confluence reached 80%–90%, Saos-2 cells were digested, centrifuged, and collected. RNA was then extracted and reverse transcribed into cDNA according to the instructions of M-MLV kit (Promega, USA). The target genes were amplified using cDNA and corresponding primers, to detect their expression in cells. The upstream primer for TGFA was 5’-GCCAACGTCAGTGAGGCAGA-3’ and that for miR-376c was 5’-ATAGAGGAAATTCCACGT-3’. The expression of TGFA and miR-376c was determined by a TaqMan detection kit (Thermo Fisher Scientific, USA). Real-time PCR was carried out using SYBR Green II fluorescent dye and IQ5TM real-time PCR system (Bio-Rad, USA), and the results were analyzed using U6 as the internal reference. The upstream primer for U6 was 5’-CGCAAGGATGACACGCAAATTC-3’. Relative expression was determined using the 2^-∆∆Ct method. The experiment was performed in triplicate.

Wang Y., Wu Y., Cai A., Ma C., Cai S., Wang H., Que Y., Xu S., Xu T, & Hu Y. (2021). Cisplatin inhibits the proliferation of Saos-2 osteosarcoma cells via the miR-376c/TGFA pathway. Bosnian Journal of Basic Medical Sciences, 21(2), 163-173.

+ Open protocol

+ Expand

Quantification of IARS2 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HL-60 cells using the TRIzol kit (Invitrogen, Carlsbad, CA, USA). Cells were collected for TRIzol treatment by centrifuging for 5 min at 2,000 rpm at 4°C and by the addition of 1 ml of TRIzol to the cell supernatant. After mixing for 5 min at room temperature, samples were precipitated and transferred to a new 1.5-ml tube.
Next, cDNA was obtained by reverse transcription using the Promega M-MLV kit (Promega, Madison, WI, USA). Quantitative real-time (qRT)-PCR was performed using a Real-Time PCR Detection System (Agilent, Santa Clara, CA, USA). SYBR Master Mixture Kit (Takara, Japan) and RNA reverse transcription were performed to determine expression. The primers used were as follows: IARS2 5′-TGGACCTCCTTATGCAAACGG-3′ (forward) and 5′-GGCAACCCATGACAATCCCA-3′ (reverse); GAPDH 5′-AGCCACATCGCTCAGACAC-3′ (forward) and 5′-GCCCAATACGACCAAATCC-3′ (reverse).

Li H., Tian Y., Li X., Wang B., Zhai D., Bai Y., Dong C, & Chao X. (2019). Knockdown of IARS2 Inhibited Proliferation of Acute Myeloid Leukemia Cells by Regulating p53/p21/PCNA/eIF4E Pathway. Oncology Research, 27(6), 673-680.

+ Open protocol

+ Expand

Real-time PCR Analysis of Atp6v0a1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real-time PCR, by using the Takara MiniBEST Universal RNA Extraction Kit (Takara, Japan), total RNA was extracted according to the manufacturer’s protocols. Then, complementary DNA (cDNA) was reversely transcribed by using the M-MLV Kit (Promega), with the heating protocol being initial activation at 95 °C for 5 min, denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 20 s and amplification for 40 cycles. Real-time PCR (20 µL) was performed with the aforementioned cDNA (1 µL). The reference gene was β-actin (forward: GCTATGTTGCC CTAGACTTCGA; reverse: GATGCCACAGGATTCCATACC). The testing gene was Atp6v0a1 (forward: GATGGCGGATCCAGACTTGT; reverse: CACGTAGTCGCCAGTCACAG).

Tao T., Liu Y., Zhang J., Lai W, & Long H. (2022). NGF-Induced Upregulation of CGRP in Orofacial Pain Induced by Tooth Movement Is Dependent on Atp6v0a1 and Vesicle Release. International Journal of Molecular Sciences, 23(19), 11440.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent (Sigma, St. Louis, MO, USA) was used to extract RNA from cells. Nanodrop 2000/2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to estimate RNA quality according to the manufacturer’s instructions. Then cDNA was reversely transcribed from RNA using Promega M-MLV kit (Heidelberg, Germany). Afterwards, SYBR Green mastermixs Kit (Vazyme, Nangjing, Jiangsu, China) was employed in qRT-PCR analysis. At last, 2^−ΔΔCt method was referred to quantitate the gene expression level. GAPDH was set as an internal control. All primer sequences of human PSMC2 during this assay are displayed in Supplementary Table S2.

Duan X., Li H., Wang M., Ju S., Li F., Chen P., Lu H., Han X, & Ren J. (2021). PSMC2/ITGA6 axis plays critical role in the development and progression of hepatocellular carcinoma. Cell Death Discovery, 7, 217.

+ Open protocol

+ Expand

qRT-PCR Analysis of PVT1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol (Ambion, Austin, TX) according to manufacturer's instructions. RNA was reverse-transcribed into complementary DNA (cDNA) by using a Promega M-MLV Kit. Quantitative real-time PCR (qPCR) was performed using SYBR Select Master Mix (Applied Biosystems, CA) on the Applied Biosystems 7500 Fast platform (Applied Biosystems). The PCR conditions were as follows: 30 seconds at 95 °C, followed by 40 cycles of 10 seconds at 95 °C, and 30 seconds at 60 °C.
The relative expression was normalized using GAPDH as an internal reference gene. Fold changes were calculated using the formula 2^–ΔΔCt. All qRT-PCR reactions were performed 3 times independently. The primer sequences used for qRT-PCR as follows: PVT1, forward 5′-AAAACGGCAGCAGGAAATGT-3′, and reverse 5′-GGAGTCATGGGTGTCAGACA-3′; GAPDH, forward 5′-AGAAGGCTGGGGCTCATTTG-3′, and reverse 5′-AGGGGCCATCCACAGTCTTC-3-3′.

Li B., Guo L.H., Ban Z.Q., Liu L., Luo L, & Cui T.Y. (2020). Upregulation of lncRNA plasmacytoma variant translocation 1 predicts poor prognosis in patients with muscle-invasive bladder cancer. Medicine, 99(28), e21059.

+ Open protocol

+ Expand

Quantifying DEPDC1B and CDK1 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was collected from all group cells after being lysed by Trizol (Cat. No. 15596-026, Invitrogen, Carlsbad, California, USA) based on the manuals. GAPDH was chosen as the reference gene in the study, the primer sequence of GAPDH, DEPDC1B, CDK1 were listed in Supplementary Table 2. The cDNA was obtained by RNA reverse transcription with M-MLV kit purchased from Promega, respectively. Then the real-time qPCR was conducted in two-step method to obtain the Ct value of GAPDH, DEPDC1B, and CDK1 according to the instructions. Average ΔCt was used to detect the DEPDC1B and CDK1 expression abundances in SK-HEP-1 and HEP3B2.1-7 cell lines and relative quantitative analysis was used to detect the expression level of DEPDC1B and CDK1.

Dang X.W., Pan Q., Lin Z.H., Wang H.H., Li L.H., Li L., Shen D.Q, & Wang P.J. (2021). Overexpressed DEPDC1B contributes to the progression of hepatocellular carcinoma by CDK1. Aging (Albany NY), 13(16), 20094-20115.

+ Open protocol

+ Expand

PICALM mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT 116 and RKO cell were collected and total RNA was extracted by Trizol. The concentration and quality of extracted RNA were determined by Nanodrop 2000/2000c spectrophotometer. The cDNA was obtained by reverse transcription using the Promega M-MLV kit. Finally, qRT-PCR was performed by using AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China). The primer sequences as follows, PICALM: sense, 5’-GAACCTTCCTGTTGCCAAACT and anti-sense, 5’-CTTAGTGGTTCCATTTCCGATG; GAPDH (internal reference): sense, 5’-TGACTTCAACAGCGACACCCA-3’ and anti-sense, 5’-CACCCTGTTGCTGTAGCCAAA-3’; The relative mRNA expression of PICALM was quantified with cycle threshold (Ct) values and normalized using the 2–∆∆Cq method.

Zhang X., Liu T., Huang J, & He J. (2022). PICALM exerts a role in promoting CRC progression through ERK/MAPK signaling pathway. Cancer Cell International, 22, 178.

+ Open protocol

+ Expand

Genotyping and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All of the primers used in this study are listed in Supporting Information Table S1.
The genotyping of SALK_094540 (usl1‐1) was performed using usl1‐1‐LP, usl1‐1‐RP, LBb1.3 primers. SAIL_552_F02 (usl1‐2) was genotyped using usl1‐2‐LP, usl1‐2‐RP and LB3 primers. The pin1‐LP, pin1‐RP and LBb1.3 primers were used to genotype SALK_047613 (pin1).
For semi‐quantitative PCR, the total RNA from the WT and usl1‐1 seedlings were extracted using a plant total RNA purification kit (GeneMark, Taichung, Taiwan, cat. no. TR02‐150). RNA was treated with a DNase as the protocol described in the RNA purification kit, and was then reverse transcribed using an M‐MLV kit (Promega, cat. no. A5003) in a reaction volume of 20 μl. The cDNA was diluted and used as a template for semi‐quantitative PCR. The cycling conditions of genotyping PCR were 94°C for 30 s, 55°C to 58°C for 30 s, and 72°C for 60 s to 120 s with 30 cycles, whereas semi‐quantitative PCR was limited to 28 cycles with the above conditions.

Yuan R., Lan J., Fang Y., Yu H., Zhang J., Huang J, & Qin G. (2018). The Arabidopsis USL1 controls multiple aspects of development by affecting late endosome morphology. The New Phytologist, 219(4), 1388-1405.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!