Reverse transcriptase

Total RNA was isolated from snap-frozen heart tissues or H9C2 cells using RNeasy Mini Kit (Qiagen). RNA (2 μg) was reverse transcribed to complementary DNA using reverse transcriptase (NEB) and quantitative real-time PCR was performed with SYBR green (Applied Biosystems). Primers efficiency was determined before gene expression analysis and specificity of primers (single product amplification) were assessed by melting curve analysis. The mRNA expression was quantified by using 2^{ΔΔ C}_T method, normalized with GAPDH, and data were represented as relative fold change of target gene for test compared with control samples. Primer sequences used are listed in Supplementary Table S8.

Total RNA was extracted from cells using the Trizol reagent (Invitrogen) and the concentration was calculated with the NanoDrop ND-2000. For mRNA semi-quantitative PCR, 2 μg of total RNA was reverse-transcribed to cDNA with reverse transcriptase (New England Biolabs) following the manufacturer’s protocols. Real-time PCR was carried out using the SYBR-green-containing PCR kit (Takara) according to the manufacturer’s instructions. MiRNA real-time PCR was carried out as previously described^{41 (link)}. The stem loop RT PCR primer sequences were as follows: miR-214-RT-(5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTGCC-3′) miR-214-realtime-Forward-(5′-CGCCGACAGCAGGCACA-3′), U6-RT-(5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATATG -3′), U6-realtime-Forward-(5′-GCGCGTCGTGAAGCGTTC-3′), universal-realtime-Reverse (5′-GTGCAGGGTCCGAGGT-3′); relative expression levels were normalized to those of the U6 snRNA.

Initial denaturation of total RNA consisted of a 2-min incubation at 95 °C followed by a 10-min incubation at 41 °C of 1.0 µl sample input, 1.675 µl reaction buffer (Life Sciences Advanced Technologies, NECB-24), 0.825 µL nucleotide mix (Life Sciences Advanced Technologies, NECN-24), 0.2 µl of 6.25 µM primers, 0.03 µl water, and 0.025 µl of RNase inhibitor (Roche) per 3.75 µl reaction. Afterwards, 1.25 µl of enzyme mix (Life Sciences NEC-1-24) was added to each reaction and the resulting 5.0 µl NASBA reactions were incubated for 30–180 min at 41 °C. Then 1.0 µl of NASBA product was added to the cell-free reaction mixture for a total of 5.5 µl.
Final concentrations of buffer components in each NASBA reaction: 13.2 mM MgCl₂ (VWR 97062-848), 75 mM KCl (VWR BDH7296-0), 10 mM DTT (Sigma GE17-1318-01), 40 mM Tris-HCl pH 8.5 (VWR RLMB-005), 15% DMSO, 2 mM each ATP, UTP, and CTP, 1.5 mM GTP, 0.5 mM ITP, 1 mM each dNTP (New England Biolabs, N0447L), 0.25 µM each primer. Enzyme mix: 5 U/ml RNaseH (New England Biolabs M0297L), 1000 U/ml reverse transcriptase (New England Biolabs, M0368L), 2500 U/ml T7 RNA polymerase (New England Biolabs, M0251L), 43.75 mg/ml BSA. Initial denaturation of sample was performed as above, after which 1.25 µl enzyme mix was added to each reaction.

Five cDNA libraries were generated for each RNA sample of different culture treatments, i.e., BL, GL, RL, WL, and CO₂, using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, UK) following the manufacturer’s protocol. Then, the mRNA was purified from total RNA using poly-T oligo-attached magnetic beads and sheared into short fragments of about 200 bp length. The first-strand cDNAs were synthesized from the cleaved short RNA fragments using random hexamer-primers (NEB, UK) and reverse transcriptase (NEB, UK). The second strand cDNAs were synthesized using DNA polymerase I (NEB, UK) and RNase-H (NEB, UK). The purified double-stranded cDNA was subjected to end repair and NEBNext adaptor ligation. Then, the resulting libraries were loaded onto a single lane of the flow cell and sequenced for 209 cycles on the Illumina HiSeq 2000 platform (Illumina, San Diego, CA, USA) at the Malaysian Genomics Resource Centre. The high-quality reads were deposited in the NCBI SRA.

The shRNA-expressing lentiviral plasmid pLV-U6-EGFP-Puro was obtained from Inovogen Tech Co (Beijing, China). Three dsDNA fragments encoding distinct STAT3 shRNAs were inserted downstream of the U6 promoter within the pLV-U6-EGFP-Puro plasmid. STAT3 cDNA was synthesized using the total RNA extracted from 293T cells and reverse transcriptase (New England Biolabs, USA), amplified by PCR, and inserted immediately downstream of a mCherry gene in the protein-expressing lentiviral plasmid pLV-EF1α-mCherry-puro. HepG2 (ATCC HB8065, USA), HuH-7 (NCACC, SCSP-526, Shanghai, China), and 293T (ATCC CRL-3216, USA) cell lines were cultured in their respective media supplied with 10% fetal bovine serum (Gibcol Co.) and 1×penicillin/streptomycin (Hyclone Co). These cell lines have been authenticated by STR profiling test and proved without contamination before used in various assays in the present study. Biological reagents, including transfection reagents, qPCR Master Mix, ECL western blot detection solution, and others, were purchased from Thermo Scientific. Chemical reagents were obtained from Sinopharm Chemical Reagent Co (Shanghai, China).