Sybr green pcr master mix

Total RNA of the liver tissues was extracted with Trizol reagent (Life Technologies, Carlsbad, CA, USA), followed by reverse transcription into cDNA (QuantiTect Reverse Transcription Kit; Qiagen, Hilden, Germany). SMYD3 mRNA levels were assessed through quantification of SMYD3 cDNA by qRT-PCR using SYBR Green PCR master mix (Bioline, Luckenwalde, Germany). The GAPDH gene (glyceraldehyde-3-phosphate dehydrogenase) was used as reference. Primer sequences were SMYD3_F: 5′-GTT GGC CTA TAT CCC AGT ATC TCT TTG CTC -3′, and SMYD3_R: 5′-ACC AGT TAG CAT ATC AGC ATC CTT GTC CTG -3′, GAPDH_F: 5′-CCA CCC ATG GCA AAT TCC ATG GCA-3′ and GAPDH_R: 5′-TCT AGA CGG CAG GTC AGG TCC ACC-3′. All qRT-PCR reactions were performed in duplicate and repeated twice (LightCycler® 480 real-time PCR system; Roche, Basel, Switzerland). The fold change of SMYD3 mRNA was normalized based upon the ΔΔCt method against expression of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Total RNA was isolated from frozen kidney sections, using Tri-reagent (Sigma Aldrich) according the manufacture’s protocol. cDNA was generated using oligo-dt primers. cTGF, TGF-β1 and Collagen IV mRNA expression was measured by Roche Light Cycler 480 (Roche, Woerden, the Netherlands) with SYBR green PCR master mix (Bioline, Ranst, Belgium). Gene expression was normalized against HPRT gene expression and analysed with linear regression analysis. Primer sequences: cTGF-F: TGACCTGGAGGAAAACATTAAGA; cTFG-R: AGCCCTGTATGTCTTCACACTG; TGF-β1-F: GCAACATGTGGAACTCTACCAGAA; TGF-β1-R: GACGTCAAAAGACAGCCACTCA; Collagen IV-F: CTGGAGAAAAGGGCCAGAT; Collagen IV-R: TCCTTAACTTGTGCCTGTCCA; HPRT-F: TGTCCGTCGTGGATCTGAC; HPRT-R: CCTGCTTCACCACCTTCTTG.

Gene expression analysis was performed on RNA extracted from 4-week-old soil-grown plants using the Genezol Total RNA kit (Geneaid) according to the manufacturer’s instructions. RNA quality was assessed by agarose gel electrophoresis and quantified by spectrophotometry. 1 µg of each sample was reverse transcribed into cDNA with the M-MuLV Reverse Transcriptase (New England Biolabs Canada). Quantitative RT-PCR amplification was done on a CFX Connect detection system (Bio-Rad Laboratories, Mississauga, On, CA) using SYBR Green PCR Master Mix (Bioline). 100 ng cDNA template and 0.4 µM of each primer (listed in Supplementary Table 1) were used in a final volume of 20 µl. The qRT-PCR thermal profile was 95 ˚C for 2 min, 40 cycles of 95 ˚C for 5 s, 60 ˚C for 10 s, and 72 ˚C for 5 s. The data were analyzed with CFX Maestro qPCR software. At1g13320 was used as a reference gene since it was previously demonstrated to be amongst the most stable genes in Arabidopsis (Czechowski et al. 2005 (link)) and was also used as a reference gene in a similar study (Vos et al. 2015 (link)). The expression level of each gene was calculated according to the ^ΔΔCt method. Three technical replicates for each treatment were analyzed.

SYBR Green PCR Master Mix (2× SensiFast^TM SYBR, Bioline, Essex, UK) was used to measure mRNA levels of PPAR, cFn, eNOS, NF-B, AT1-R, and ETA-R genes in tissues. The overall reaction mixture were20 μL, with two 10 μL × SensiFast SYBR, 2 μL cDNA, 6.4 μL H₂O (d.d. water), and 0.8 μL of each primer. A melting curve was created for the specificity of the PCR product confirmation. Sangon Biotechnology (Shanghai, China) synthesized the PCR primers, which are shown in (Supplementary Table S1). The data were processed with SPSS 19, and the 2^−ΔΔCt technique was used to calculate the mRNA expression of each gene per sample, with GAPDH as the control.

For evaluation of tissue parasitism, T. cruzi DNA was quantified in the heart samples by quantitative PCR (qPCR) analysis. DNA was isolated using a Wizard Genomic DNA purification kit (Promega, USA) according to the manufacturer’s instructions. DNA was quantified as a function of absorbance at 280 nm using a Varioskan spectrophotometer (Thermo Scientific, USA). qPCR analyses and DNA amplification were performed with SYBR green PCR Master Mix (Bioline, USA) using satellite DNA for T. cruzi Dm28c on an Applied Biosystems 7300 reverse transcription-PCR (RT-PCR) system (Thermo Fisher) using the following primers: forward, 5′-GCTCTTGCCCACAMGGGTGC-3′; reverse, 3′-CAAGCAGCGGATAGTTCAGG-5′. The parasitic load of T. cruzi in the cardiac tissues was calculated from a standard curve constructed using homogenized heart tissues enriched with 10⁶ trypomastigotes of T. cruzi and serially diluted to provide a 7-log curve in a range of 10⁻¹ to 10⁵ parasite equivalents (par eq)/ml according to Duffy et al. (34 (link)). The limit of detection of the assay was 0.7 par eq/ml ( 95% confidence interval [CI], 0.0089 to 0.7925 par eq/ml) with a limit of quantification of 1.4 par eq/ml of homogenate (Fig. S2).

To prepare total RNA, cells were harvested using the TRIzol reagent (Invitrogen). miRNA levels were quantified using the HB miR Multi Assay Kit™ (Heimbiotek, Seongnam, Korea) according to the manufacturer’s instructions. The abundance of transcripts was assessed by quantitative PCR (qPCR) analysis using SYBR Green PCR Master Mix (Bioline) and gene-specific primer sets on a StepOne Plus instrument (Applied Biosystems, Foster City, CA, USA). GAPDH mRNA and RNU6B RNA were used as internal controls for normalization. The primer sequences are listed in Table 1.