Total RNA was extracted from IPEC-J2 cells (1 × 107) or pig jejunal and ileal tissue, as described above. The cDNA was then produced from the total RNA using a reverse transcriptase kit (Accurate Biotechnology, Hunan, Changsha, China), and was used for qRT-PCR amplification using SYBR Green Realtime PCR Master Mix (Accurate Biotechnology, Hunan, Changsha, China) on a LightCycler 480 instrument (Roche Applied Science, Mannheim, Germany). GAPDH was used as an internal reference. The primer sequences are shown in Supplementary Table S1 . The relative expression level was determined using the 2−∆∆Ct method [32 ].
Reverse transcriptase kit
Manufactured by Accurate Biology
Sourced in China
The Reverse Transcriptase Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It contains the necessary enzymes, buffers, and reagents to perform this RNA-to-cDNA conversion process, which is a fundamental step in various molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 instrument, by Roche (1 mentions)
Sybr green realtime pcr master mix, by Accurate Biology (1 mentions)
Steadypure universal rna extraction kit, by Accurate Biology (1 mentions)
Turbo dna free dnase reagents, by Thermo Fisher Scientific (1 mentions)
Sybr green premix pro taq hs qpcr kit 2, by Accurate Biology (1 mentions)
Lightcycler 96, by Roche (1 mentions)
Real time fluorescence quantitative pcr system, by Bio-Rad (1 mentions)
Trizol reagent, by Accurate Biology (1 mentions)
Sybr green pro taq hs premix, by Accurate Biology (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
5 protocols using reverse transcriptase kit
1
Quantitative Real-Time PCR Analysis of Gene Expression
2
Transcriptome Analysis of Streptomyces coelicolor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract RNA, S. coelicolor M145 and its derivations were grown at 30 °C in liquid YBP medium, and the mycelia were collected. Total RNA was isolated with a SteadyPure universal RNA extraction kit (Accurate Biology, Changsha, China) and treated twice with Turbo DNA-free DNase reagents (Ambion, Austin, TX, USA). The quality of RNA was analyzed by electrophoresis. RT-PCR experiments were conducted with a reverse transcriptase kit (Accurate Biology, Changsha, China), and RT-qPCR assay was performed on a Roche LightCycler480 thermal cycler system as previously described [42 (link)], using the primers listed in Supplementary File (Table S2) . The data were normalized to the expression level of the hrdB gene that encodes the major sigma factor of Streptomyces [43 (link)].
3
Gene Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using TRIZOL reagents. The primers of human GAPDH and MARCH1 were custom-synthesized products of Takara (Dalian, China):
GAPDH sequences:
F: 5′-GCACCGTCAAGGCTGAGAAC-3′,
R: 5′-TGGTGAAGACGCCAGTGGA-3'.
MARCH1 sequences:
F: 5′-CTGCTGTGAGCTCTGCAAGTATGA-3′,
R: 5′-TACGTGGAATGTGACAGAGCAGAA-3'.
cDNAs were prepared using a Reverse Transcriptase Kit (#AG11711, ACCURATE BIOLOGY, Changsha, China). The cDNA amplification reactions were carried out using a SYBR® Green Premix Pro Taq HS qPCR Kit II (#AG11702, ACCURATE BIOLOGY, Changsha, China). Quantitative real-time PCR analysis reactions were performed on LightCycler® 96 (Roche, Switzerland). The PCR products were used for agarose gel electrophoresis. Grayscale analysis was performed by ImageJ.
GAPDH sequences:
F: 5′-GCACCGTCAAGGCTGAGAAC-3′,
R: 5′-TGGTGAAGACGCCAGTGGA-3'.
MARCH1 sequences:
F: 5′-CTGCTGTGAGCTCTGCAAGTATGA-3′,
R: 5′-TACGTGGAATGTGACAGAGCAGAA-3'.
cDNAs were prepared using a Reverse Transcriptase Kit (#AG11711, ACCURATE BIOLOGY, Changsha, China). The cDNA amplification reactions were carried out using a SYBR® Green Premix Pro Taq HS qPCR Kit II (#AG11702, ACCURATE BIOLOGY, Changsha, China). Quantitative real-time PCR analysis reactions were performed on LightCycler® 96 (Roche, Switzerland). The PCR products were used for agarose gel electrophoresis. Grayscale analysis was performed by ImageJ.
4
Quantifying YBX1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Accurate Biotechnology, China) and 1 µg of total RNA was used for synthesis of first-strand cDNA with a reverse transcriptase kit (Accurate Biotechnology, China). The mRNA level was measured by qPCR with Kit AG11701 (Accurate Biotechnology, China) on a Real-time fluorescence quantitative PCR system (Bio-Rad, USA). The primers used in the study were as follows: YBX1 Forward: AAGGAGAAAAGGGTGCGGAG; YBX1 Reverse: CCTACGACGTGGATAGCGTC; GAPDH Forward: CGAGATCCCTCCAAAATCAA; GAPDH Reverse: TTCACACCCATGACGAACAT. GAPDH was used as control. Relative expression was determined with GAPDH control through the 2−∆∆Ct method.
5
Quantitative Analysis of Colonic Fibrosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After sample collection, colons were frozen in liquid nitrogen for RNA extraction, or fixed in 4% paraformaldehyde. The fixed colons were then dehydrated in gradient ethanol, embedded in paraffin, sliced into 4-μm-thick sections, and subjected to Masson’s trichrome and hematoxylin and eosin (H&E) staining. Subsequently, collagen deposition (blue staining) was quantified using the ImageJ software (National Institutes of Health).
The expression of fibrotic indicators in colons was determined by qPCR. Briefly, total RNA was extracted from colons using the TRIzol reagent (Takara, Japanese) and then converted to cDNA using the reverse transcriptase kit (Accurate Biology, China). Subsequent qPCR was performed on the CFX Connect real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) with a SYBR Green Pro Taq HS Premix (Accurate Biology, China). The primer sequences are shown in the Additional file1 : Table S1.
The expression of fibrotic indicators in colons was determined by qPCR. Briefly, total RNA was extracted from colons using the TRIzol reagent (Takara, Japanese) and then converted to cDNA using the reverse transcriptase kit (Accurate Biology, China). Subsequent qPCR was performed on the CFX Connect real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) with a SYBR Green Pro Taq HS Premix (Accurate Biology, China). The primer sequences are shown in the Additional file
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!