E coli dh5α cells

The gene (AEE72695) coding for CaMan5_18 from Cutibacterium acnes strain 266 was synthesized and codon-optimized for expression in Escherichia coli by Gen9 Inc. The gene was subcloned into the ligation-independent cloning (LIC) vector pNIC-CH2 adding a C-terminal, non-cleavable hexa-histidine tag (https://ki.se/en/mbb/protein-production-platform) using the following forward and reverse primers:
Site-directed mutagenesis to generate a catalytically deficient CaMan5_18 mutant (E140Q/E259Q) was performed using the following forward and reverse primers:
The PCR samples contained 50 ng plasmid DNA, 2 U Phusion High-Fidelity DNA polymerase (Thermo Fisher), 230 nM of each primer, 500 μM of each dNTP, and 1 x HF Phusion buffer (Thermo Fisher). For mutagenic PCR the following conditions were used: 95°C for 30 s, 30 cycles of 95°C for 30 s; 68°C for 9 min, with a final incubation at 68°C for 10 min. The resulting PCR products were treated with 10 U of DpnI (Thermo Fisher) to degrade the methylated template-DNA. The remaining PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher), and transformed into chemically competent E. coli DH5α cells (Invitrogen) followed by plating on Luria-Bertani (LB) agar supplemented with 50 μg mL^-1 kanamycin at 37°C for 17 h.

Cloning was conducted using E. coli DH5α cells (Invitrogen, Carlsbad, USA). All expressions were performed with E. coli C41 (DE3) cells (Lucigen^® Corporation, Middleton WI, USA) containing pGlysivb and pCOLADuet^® or pET28a with β-gal-cyt b₅.

Total RNA was isolated from hMSC cells that were stimulated to express TSG-6 by incubation of 3 × 10⁴ cells/cm² over night with 10 ng/ml of TNF-α in CCM containing a reduced concentration of 2% FBS [32 (link)]. About 1 μg of total RNA was used to produce the first strand cDNA pool by RT-PCR (Superscript II/oligo dT_12-18; Invitrogen) using a thermocycler (C100TM Thermal Cycler; BIO-RAD, Hercules, CA). cDNAs encoding hTSG-6 (GenBank accession number: NM_007115) were amplified by PCR using the following primers: 5’- CGGGGTACCATGATCATCTTAATTTACTT -3’ (sense), 5’- GGTGATCAGTGGCTAAATCTTCCA -3’ (anti-sense). The PCR products were sub-cloned into the Kpn I and Spe I sites in multi-cloning sites of a pEF4-Myc/His plasmid (cat, # V942-20; Invitrogen) and the plasmid was amplified in E.coli DH5α cells (cat. # 18265–017; Invitrogen).

For construction of the human Dicer expression vector pTT5-Dicer, a PCR fragment encoding Dicer was first generated from plasmid pFRT/TO/FLAG/HA-DEST DICER [provided as a gift from Thomas Tuschl (Addgene plasmid # 19881)] [48 (link)] and inserted between the NotI and HindIII sites of the pTT5SH8Q1 vector to allow for expression of Dicer with a C-terminal StrepTagII/His₈ tag [34 (link)]. The expression vector for the catalytically-inactive Dicer D1320A/D1709A variant was prepared from pTT5-Dicer using the Stratagene QuikChangeII site-directed mutagenesis method. Plasmids were amplified in Escherichia coli (E. coli) DH5α cells (Invitrogen) grown in LB medium supplemented with 100 mg/L amplicilin and purified using the QIAGEN Plasmid Giga Kit. Plasmids were stored at 4 °C in water at a concentration of 1 mg/mL.
The pUC19-HH-pre-let-7a-1-HDV vector used for in vitro transcription of pre-let-7a-1 was constructed using a pUC19 vector, which allows for synthesis of pre-let-7a-1 flanked by a 5’ Hammerhead ribozyme (HH) and a 3’ Hepatitis delta virus (HDV) ribozyme. Plasmids were amplified in E. coli DH5α cells grown in LB medium supplemented with 100 mg/L ampicillin and purified using the QIAGEN Plasmid Maxi Kit. Plasmids were linearized with HindIII (New England Biolabs) and stored as is at − 20 °C at a concentration of 1 mg/mL. All plasmids were verified by DNA sequencing.

E. coli DH5α cells (Invitrogen) were previously diluted five times on 10% glycerol (OD₆₀₀ [optical density at 600 nm] = 60 ± 10) and stored in aliquots of 20 µL at −80 °C. One aliquot of cells (SQ171, for experiments with aminoglycoside-resistant ribosomes) was mixed with 1.5 pmol of Phe-[Cy5]tRNA^Phe or 2 pmol of fMet-[Cy5]tRNA^fMet (prepared as in ref. 28 (link)) and incubated 1 min on ice. The mixture was transferred to a cold (∼4 °C) electroporation cuvette (MBP, 1 mm) and pulsed with 1.9 kV with a MicroPulser (Bio-Rad), which generated a decay time constant of 5.8 ± 0.1. Immediately after, 1 mL of EZ RDM (Teknova) + 0.2% glucose was added to the cuvette to gently resuspend the cells. The suspension was pipetted down to a culture tube and incubated for 30 min at 37 °C and shaking at 200 rpm. The cells were pelleted at RCF 2415 × g for 3 min (MiniSpin, Eppendorf) and washed three times with fresh RDM (room temperature) to remove nonelectroporated tRNA. Cells were finally resuspended in RDM (OD₆₀₀ = 0.02) containing 1 µM SYTOX blue dead cell stain (Invitrogen).

The generation of the RAD-resistant HSP90 variant (HSP90rr) was described earlier^{27 (link)}. Plasmid pUC:HSP90rr served as template for site-directed mutagenesis. Primers (Supplementary data, Table S1) were phosphorylated using ATP and polynucleotide kinase (PNK, New England Biolabs)⁹⁰ and then used to prime a PCR amplification of pUC:HSP90rr using the iProof-PCR kit for GC-rich DNA (#172–5320) from Bio-Rad Laboratories (München, Germany). Following amplification (30 cycles), the linear PCR product was subjected to ligation (3 h, RT) to form circular plasmids. These were then used to transform competent E. coli DH5-α cells (#18265–017, Invitrogen, Karlsruhe, Germany). After amplification and purification⁹⁰ via caesium-chloride density gradient ultracentrifugation (50% w/v CsCl, 6 h, 90,000 rpm, 20 °C, rotor NVT90, Beckman, Krefeld, Germany), the pUC:HSP90rr-derived mutants were verified by DNA sequencing (LGC Genomics, Berlin, Germany).
The derivative of the plasmid pJC45^{91 (link)}, pJC45:HSP90, was also used for site-directed mutagenesis. The same set of primers (Table S1) was used. PCR, ligation, transformation of E. coli and CsCl purification of plasmids were performed the same as for the site-directed mutagenesis of pUC:HSP90rr.