Log In Sign up
The largest database of trusted experimental protocols

Lenti sgrna efs gfp

Manufactured by Addgene
Visit Supplier

The Lenti_sgRNA_EFS_GFP is a lentiviral vector that expresses a single guide RNA (sgRNA) and green fluorescent protein (GFP) under the control of the EFS promoter. This vector is designed for CRISPR-Cas9 mediated gene editing applications.

Automatically generated - may contain errors

Lab products found in correlation

Mscv cas9 puro, by Addgene (3 mentions) Lenticrisprv252, by Addgene (2 mentions) Dcas9 krab mecp2, by Addgene (2 mentions) Pbabe puro, by Addgene (2 mentions) Lenticrispr v2, by Addgene (2 mentions) Lenticas9 blast, by Addgene (2 mentions) Blasticidin, by Thermo Fisher Scientific (1 mentions) Lrcherry2, by Addgene (1 mentions) Sanger sequencing, by Source Bioscience (1 mentions) Sgrna oligonucleotides, by Integrated DNA Technologies (1 mentions) Phr sffv krab dcas9 p2a mcherry, by Addgene (1 mentions) Synthesized oligonucleotides, by Integrated DNA Technologies (1 mentions) Polybrene, by Merck Group (1 mentions) Sgrna oligonucleotides, by Merck Group (1 mentions) Prda 256, by Addgene (1 mentions) Rpmi media, by Thermo Fisher Scientific (1 mentions)

17 protocols using lenti sgrna efs gfp

1

Generating Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
MFL2 cells were infected with Cas9 expressing vector, MSCV_Cas9_puro (gift from Christopher Vakoc; Addgene plasmid # 65655, Watertown, MA, USA) and infected cells were selected with puromycin. Resistant cells were then transfected with sgRNA expressing vector LRG, :Lenti_sgRNA_EFS_GFP (gift from Christopher Vakoc; Addgene # 65656) tagged with GFP targeting the indicated gene. Gene deletions were confirmed by Western blot. Clonal populations of deleted cells were obtained by serial dilutions.
Anderson R., Pladna K.M., Schramm N.J., Wheeler F.B., Kridel S, & Pardee T.S. (2023). Pyruvate Dehydrogenase Inhibition Leads to Decreased Glycolysis, Increased Reliance on Gluconeogenesis and Alternative Sources of Acetyl-CoA in Acute Myeloid Leukemia. Cancers, 15(2), 484.
+ Open protocol
+ Expand
2

CRISPR-Cas9 Gene Editing in AML Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Cas9-expression vector, lentiCas9-Blast, was a gift from Dr. Feng Zhang at the Broad Institute of Harvard and MIT (Addgene plasmid # 52962). Cas9 protein was introduced to human AML cell lines by lentiviral transduction and selected with 10 µg/mL Blasticidin (Thermo, R21001). The sgRNA-expression vectors, LRG (Lenti_sgRNA_EFS_GFP) (Addgene plasmid # 65656) and LRCherry2.1 (Addgene plasmid # 108099), were gifts from Christopher Vakoc. Cells were transduced with sgRNA lentivirus and sorted for GFP+ cells 48 hours following transduction (except for negative-selection competition assay). CRISPR sgRNA sequences used were:
sgKAT6A-1: CATACCACTGTTGCCACAGT; sgKAT6A-2: TTCGAGTGAAGGCCTTACGG;
sgKAT6A-3: CTCATCTCCTGTGCCGACTG; sgKAT6A-4: TTAGTGTTGAGCCGATAAAG;
sgKat6a-1: TGCAGCTCCTGTCGTGACCA; sgKat6a-2: GCTATTGCCGCAGTCCGCGC;
sgKat6a-3: CTCGTCTCCTGCGCGGACTG; sgKat6a-4: CGGCGCTATGCTAATCCAAT;
sgKat6a-5: TATGTCAGATATGCCGACCT; sgKat6a-6: CTCAATGCACTGCCACCGTA;
sgRosa26: GAAGATGGGCGGGAGTCTTC; sgNonTarget: ATTGAGAATTCGTTTCAAGG.
Except for the negative selection competition assay which used all the sgRNAs, in other assays: human sgKAT6A-2 and mouse sgKat6a-6 were used, if not indicated otherwise.
Yan F., Li J., Milosevic J., Petroni R., Liu S., Shi Z., Yuan S., Reynaga J.M., Qi Y., Rico J., Yu S., Liu Y., Rokudai S., Palmisiano N., Meyer S.E., Sung P.J., Wan L., Lan F., Garcia B.A., Stanger B.Z., Sykes D.B, & Andrés Blanco M. (2022). KAT6A and ENL form an epigenetic transcriptional control module to drive critical leukemogenic gene expression programs. Cancer discovery, 12(3), 792-811.
+ Open protocol
+ Expand
3

Engineered SETD2 and CRISPR-engineered MMP1 enhancer

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Human SETD2 with deletion of the N-terminal 1241 amino acid residues was tagged with 3xFLAG at the N-terminus and cloned into pBABE-puro (Addgene). sgRNAs were designed using Optimized CRISPR Design (http://crispr.mit.edu/) and cloned into lentiCRISPRv252 (link) (Addgene). sgRNA targeting the intron 7 enhancer in MMP1 was cloned into LRG53 (link) (Lenti_sgRNA_EFS_GFP, Addgene). All constructs were confirmed by DNA sequencing. dCas9–KRAB–MeCP2 was obtained from Addgene34 (link). Lentivirus was produced as described51 (link). The sequences of sgRNAs were summarized in Supplementary Table 7.
Xie Y., Sahin M., Sinha S., Wang Y., Nargund A.M., Lyu Y., Han S., Dong Y., Hsieh J.J., Leslie C.S, & Cheng E.H. (2022). SETD2 loss perturbs the kidney cancer epigenetic landscape to promote metastasis and engenders actionable dependencies on histone chaperone complexes. Nature cancer, 3(2), 188-202.
+ Open protocol
+ Expand
4

CRISPR-Cas9 Gene Deletion in MFL2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MFL2 cells were infected with the Cas9 expressing vector, MSCV_Cas9_puro (gift from Christopher Vakoc) (Addgene plasmid # 65655) and infected cells selected with puromycin. Resistant cells were then transfected with sgRNA expressing vector LRG (Lenti_sgRNA_EFS_GFP) also a gift from Christopher Vakoc (Addgene plasmid # 65656) tagged with GFP targeting the indicated genes, Prkaa1 and the safe harbor locus, Rosa26. Gene deletion was confirmed by western blot. Clonal populations of deleted cells were obtained by serial dilution.
Ghiraldeli L., Anderson R., Pladna K, & Pardee T.S. (2022). Adenosine Monophosphate Activated Protein Kinase (AMPK) Enhances Chemotherapy Response in Acute Myeloid Leukemia (AML). Cancer letters, 535, 215659.
+ Open protocol
+ Expand
5

CRISPR-based Gene Knockout in Mouse and Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Using the web interface of UCSC Genome Browser’s CRISPR design software (https://genome.ucsc.edu/), multiple small guide RNAs (gRNAs) targeting either exon 1 of mouse Jarid2 or Ezh2 genes, or exon 3 of mouse or human Jarid2/JARID2 genes were designed. Off-target activity of these gRNAs were further evaluated with Blastn (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Two complementary oligos were designed to generate double stranded gRNA with flanking BsmBI restriction sites. The sequences of the gRNAs used in this study are listed in Key Resources Table. These oligos were self-annealed and cloned into BsmBI digested LRB plasmid (Lenti_sgRNA_EFS_BFP). This is a modified version of Lenti_sgRNA_EFS_GFP (Addgene #65656), where GFP was replaced by blue fluorescent protein (BFP). 32D or HEL cells stably expressing Cas9 in which the expression of Cas9 is linked to GFP via an internal ribosome entry site (IRES) were transduced with lentiviruses to express either mouse or human gRNAs, respectively. 48 hr post-transduction, stable cell lines expressing both Cas9 and gRNA were established by sorting GFP+BFP+ cells by FACS. Upon expansion of these cells, western blot was performed to validate successful inactivation of the target gene.
Celik H., Koh W.K., Kramer A.C., Ostrander E.L., Mallaney C., Fisher D.A., Xiang J., Wilson W.C., Martens A., Kothari A., Fishberger G., Tycksen E., Karpova D., Duncavage E.J., Lee Y., Oh S.T, & Challen G.A. (2018). JARID2 Functions as a Tumor Suppressor in Myeloid Neoplasms by Repressing Self-Renewal in Hematopoietic Progenitor Cells. Cancer cell, 34(5), 741-756.e8.
+ Open protocol
+ Expand
6

Quantifying Cellular Fitness Changes

Check if the same lab product or an alternative is used in the 5 most similar protocols
KBM7 cells constitutively expressing Cas9_Blast (Addgene #52962) were transduced with lentivirus expressing sgRNAs against VHL, GAPDH, RPL5 or in the gene desert of MYC in the GFP vector LRG (Lenti_sgRNA_EFS_GFP) (Addgene #65656, see Supplementary Table 4). GFP-expressing cells were mixed with GFP-negative cells at a 1:1 ratio. The mixed populations were grown for 21 days, and monitored by flow cytometry in 7-day intervals. Data was analyzed with FlowJo (gating strategy see Supplementary Figure 3) and percentages of the respective GFP populations were normalized to day 0.
Hanzl A., Casement R., Imrichova H., Hughes S.J., Barone E., Testa A., Bauer S., Wright J., Brand M., Ciulli A, & Winter G.E. (2022). Functional E3 ligase hotspots and resistance mechanisms to small-molecule degraders. Nature chemical biology, 19(3), 323-333.
+ Open protocol
+ Expand
7

Quantifying Cellular Fitness Changes

Check if the same lab product or an alternative is used in the 5 most similar protocols
KBM7 cells constitutively expressing Cas9_Blast (Addgene #52962) were transduced with lentivirus expressing sgRNAs against VHL, GAPDH, RPL5 or in the gene desert of MYC in the GFP vector LRG (Lenti_sgRNA_EFS_GFP) (Addgene #65656, see Supplementary Table 4). GFP-expressing cells were mixed with GFP-negative cells at a 1:1 ratio. The mixed populations were grown for 21 days, and monitored by flow cytometry in 7-day intervals. Data was analyzed with FlowJo (gating strategy see Supplementary Figure 3) and percentages of the respective GFP populations were normalized to day 0.
Hanzl A., Casement R., Imrichova H., Hughes S.J., Barone E., Testa A., Bauer S., Wright J., Brand M., Ciulli A, & Winter G.E. (2022). Functional E3 ligase hotspots and resistance mechanisms to small-molecule degraders. Nature chemical biology, 19(3), 323-333.
+ Open protocol
+ Expand
8

CRISPR-Mediated Deletion of Retroviral LTRs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For CRISPR/Cas9 deletion of LTRs, sgRNA oligonucleotides (Integrated DNA Technologies) were designed to target upstream and downstream of the LTRs of interest, using Benchling (https://benchling.com) and annealed. Either the upstream or the downstream guide was cloned into plasmid LRG (Lenti_sgRNA_EFS_GFP; deposited by C. Vakoc (Addgene 65656), which expresses GFP. The other guide was cloned into lentiCRISPR v2, deposited by F. Zhang (Addgene 52961). Clones were verified by Sanger sequencing (Source Bioscience). Guide sequences are listed in Supplementary Table 6.
Frost J.M., Amante S.M., Okae H., Jones E.M., Ashley B., Lewis R.M., Cleal J.K., Caley M.P., Arima T., Maffucci T, & Branco M.R. (2023). Regulation of human trophoblast gene expression by endogenous retroviruses. Nature Structural & Molecular Biology, 30(4), 527-538.
+ Open protocol
+ Expand
9

CRISPR-Mediated Silencing of IRF1 Enhancer

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The single guide (sg) RNAs were designed for IRF1 target regions using CHOPCHOP (http://chopchop.cbu.uib.no). A human genome non-targeting gRNA was used as a negative control. Synthesized oligonucleotides (Integrated DNA Technologies) were annealed and cloned into the Esp3I restriction sites of lentiviral expression vector Lenti_sgRNA_EFS_GFP (Addgene plasmid # 65656 (38 (link))). Sanger sequencing confirmed sgRNAs insertion. The gRNA target sequences are non-targeting, 5’-GTTCCGCGTTACATAACTTA-3’, and IRF1 enhancer targeting, 5’- TCGGCGCGCAGGCACTCAGA-3’.
Lentivirus was produced in HEK293FT cells used to transduce target cells in the presence of 4 µg/mL polybrene (Sigma). For IRF1 Enhancer silencing, hSAECs were first transduced with the lentiviral vector pHR-SFFV-KRAB-dCas9-P2A-mCherry (Addgene plasmid # 60954 (38 (link))). The vector expresses a fusion protein of mammalian codon-optimized Streptococcus pyogenes dCas9 (DNA 2.0) fused at the N terminus with the Kox1 KRAB domain and two SV40 nuclear localization sequences at the C terminus. mCherry-expressing hSAECs were transduced with the lentiviral sgRNA expression vector. Two days later, the dual mCherry and GFP-expressing cells were sorted and cultured for RSV infection experiments.
Qiao D., Xu X., Zhang Y., Yang J, & Brasier A.R. (2023). RSV replication modifies the XBP1s binding complex on the IRF1 upstream enhancer to potentiate the mucosal anti-viral response. Frontiers in Immunology, 14, 1197356.
+ Open protocol
+ Expand
10

sgRNA Design and Lentiviral Cloning for ZNF204P

Check if the same lab product or an alternative is used in the 5 most similar protocols
sgRNAs targeting the regions encompassing transcription start site (+/− 200 relative to TSS) of ZNF204P was designed using CHOPCHOP v3 (35 (link)). The top and bottom strands of each targeting oligonucleotides were phosphorylated and annealed in thermocycler under settings: 37°C for 30 minutes, 95°C for 5 minutes, with ramping down to 25°C at a rate of 5°C/min. sgRNA sequences are included in Supplementary Table 1. Lenti_sgRNA_EFS_GFP (Addgene, #65656) vector (LRG) was digested with BsmBI (NEB) at 55°C for 1 hour, and subsequently annealed with each respective sgRNA duplex.
Hwang J.H., Lee J., Choi W.Y., Kim M.J., Lee J., Chu K.H., Kim L.K, & Kim Y.J. (2022). ZNF204P is a stemness-associated oncogenic long non-coding RNA in hepatocellular carcinoma. BMB Reports, 55(6), 281-286.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!