All libraries were independently prepared from separately cultured samples in duplicate, according to previously described protocols51 (link)–53 (link). Size selection was performed by extracting 200–400 bp DNA fragments on a 2% agarose E-gel (Invitrogen) before PCR amplification, then extracted using RNeasy MinElute cleanup kits (Qiagen). PCR amplification was performed using ≤ 14 cycles, and the resulting DNA quantified by Qubit fluorometric quantitation. Sequencing was performed using single-end reads on the Illumina HiSeq2000 sequencer.
Agarose e gel
Manufactured by Thermo Fisher Scientific
Sourced in United States
Agarose E-gel is a laboratory equipment used for the separation and analysis of DNA and RNA samples. It is a type of agarose gel electrophoresis system that provides a simple and efficient method for visualizing nucleic acid fragments.
Automatically generated - may contain errors
Lab products found in correlation
Hiseq2000 flow cell v3, by Illumina (5 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (5 mentions)
Ampure xp magnetic beads, by Beckman Coulter (3 mentions)
Miseq platform, by Illumina (3 mentions)
Rneasy minelute cleanup kit, by Qiagen (2 mentions)
Primestar max dna polymerase, by Takara Bio (2 mentions)
Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (2 mentions)
Bead beating step, by Biospec (2 mentions)
Nucleospin gel and pcr clean up, by Macherey-Nagel (2 mentions)
Hiseq 2000 platform, by Illumina (2 mentions)
Zymoclean gel dna recovery kit, by Zymo Research (2 mentions)
Eb buffer, by Qiagen (2 mentions)
Reverse primer, by Integrated DNA Technologies (2 mentions)
Forward primer, by Integrated DNA Technologies (2 mentions)
Ultrapure water, by Thermo Fisher Scientific (2 mentions)
Phusion hs 2 polymerase, by Thermo Fisher Scientific (2 mentions)
Idt oligo analyzer, by Integrated DNA Technologies (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
E gel power snap electrophoresis device, by Thermo Fisher Scientific (2 mentions)
Hiscribe t7 in vitro transcription kit, by New England Biolabs (2 mentions)
42 protocols using agarose e gel
1
DNA Library Preparation and Sequencing
2
Pyrosequencing-based Influenza Virus Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNAs were extracted from 200 μl of allantoic fluids of infected eggs using the MagNA Pure Total Nucleic Acid Kit (Roche) and the MagNa Pure LC 2.0 Robot (Roche). RNA was eluted in a final volume of 50 μl. SuperScriptTMIII One-Step HiFi System (Invitrogen) was used to produce RT-PCR products of all genes except for the HA (previously determined by the HI assay) for pyrosequencing. Primers were used at a final concentration of 0.4 μM. The RT-PCR conditions were 50°C for 30 minutes, denaturation at 94°C for 2 minutes, followed by 45 cycles of 94°C for 15 seconds, annealing 55°C for 30 seconds, 68°C for 1 minute. The RT-PCR products were examined on a 96-well, 2% agarose E-gel (Invitrogen) to confirm amplification of an appropriately sized DNA band. A negative control (water) was used to determine the level of background associated with the primers. Nucleotide dispensations for the pyrosequencing assay were customized to improve the detection of strain-specific nucleotide differences [39] (link). The modified dispensation CCATTGCAAGCCAATGCCAATGCATG was used for all genes of influenza A (H3N2) influenza viruses. The dispensation orders for influenza A (H7N9) genes were as follows: NA, TACTATGCACTGCAGTC ; NS, CGATCTAGATG ; M, ATATCGCTCGTTA ; NP, CTACTAGATGACATGA ; PA, GTAGGACTCTGATAGC ; PB1, AGTACGACAGTCTGTG PB2, GTGACAGATCTCTC .
3
16S rRNA Amplicon Sequencing of Fecal Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from women and mice fecal samples, using the Invitrogen Purelink Microbiome DNA extraction kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions, following a bead-beating step (BioSpec, Bartlesville, OK) for 2 min. Extracted DNA was used for PCR amplification of the variable V4 region of the 16S rRNA gene by using the 515F (AATGATACGGCGACCACCGAGATCTACACGCT) barcoded and 806R (TATGGTAATTGTGTGYCAGCMGCCGCGGTAA) primers. A reaction containing a final concentration of 0.04% of each primer and 0.5% of PrimeSTAR Max DNA Polymerase (Takara-Clontech, Shiga, Japan) in 50 μl total volume was used. PCR reactions were carried out by 35 cycles of denaturation (95 °C), annealing (55 °C), and extension (72 °C), with final elongation at 72 °C. PCR products were purified using AMPure XP magnetic beads (Beckman Coulter, Brea, CA) and quantified using Quant-iT PicoGreen dsDNA quantitation kit (Invitrogen, Carlsbad, CA). Samples were then pooled at equal amounts, loaded on 2% agarose E-Gel (Invitrogen, Carlsbad, CA), purified, and sent for sequencing using the Illumina MiSeq platform (Genomic center, Azrieli Faculty of Medicine, BIU, Israel).
4
RT-PCR Assay for Norovirus Genogroups
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the available sequences of the N ORFs were aligned, and specific sets of primers were manually designed in regions that were fully conserved within a genogroup but showed substitutions in the three other groups. Four pairs of genogroup-adapted primers were designed: oPVP521 and 522, oPVP523 and 524, oPVP536 and 537, and oPVP546 and 547 (Figure 1 and Table S2 ). They were used at 0.4 μM in a final reaction volume of 50 μL containing 2 μL of total RNA. For RT-PCRs, a SuperScript III One-Step with Platinum Taq High-Fidelity kit was used, starting with a reverse-transcription step of 30 min at 58 °C, followed by 2 min at 94 °C and 40 cycles including 30 s at 94 °C, 30 s at 60 °C and 30 s at 68 °C. After PCR, a volume of 10 μL of these reactions was loaded on a 2% agarose E-Gel (Invitrogen) and migrated for 15 min before observation under UV light.
5
Fecal 16S rRNA Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from fecal samples using the PowerSoil DNA Isolation Kit (MoBio, Carlsbad, USA), according to the manufacturer’s protocol, and following a 2-min bead-beating step (Biospec). The V4 region of the bacterial 16S rRNA gene was amplified using the 515F and 806R barcoded primers following the Earth Microbiome Project protocol [10 (link)]. PCR protocol included 2 μl 515F primer (10 μM), 2 μl 806R primer (10 μM), 25 μl PrimeSTAR Max PCR Readymix (Takara, Mountain View, USA), 17 μl ultra-pure water, and approximately 20 ng of DNA. PCR reaction conditions included 3 min at 95 °C followed by 30 cycles of [10 s at 98 °C, 5 s at 55 °C, and 20 s at 72 °C], and final elongation for 1 min at 72 °C. Amplicons were purified using AMPure XP magnetic beads (Beckman Coulter, FL, USA) according to the manufacturer’s protocol. DNA was quantified using Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, Carlsbad, USA), and equimolar amounts of DNA were pooled from each sample, to ensure equal read depth. After running on a 2% agarose E-Gel (Invitrogen, Carlsbad, USA), DNA was extracted from the gel using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Düren, Germany) and sequenced using the Illumina Miseq platform at the Genomic Center, Azrieli Faculty of Medicine, BIU, Israel.
6
Biofilm RNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biofilm cells were grown for 24-h in TSB OR in pH 10 medium and were harvested by centrifugation (4000 rpm, 15 min) at 4°C. Cells were then resuspended with TRIzol (Invitrogen, Carlsbad, USA) and disrupted with a Mini-Bead beater (Biospec, California, USA). Total RNA was isolated according to the manufacturer's instructions for TRIzol-chloroform extraction (Invitrogen, California, USA). Genomic DNA was removed with Turbo DNase. Ribosomal RNA (rRNA) was removed with a Ribo-Zero Magnetic kit (G+/G-Bacteria) (Epicentre, Wisconsin, USA). The cDNA library was constructed with extracted mRNA according to a TruseqTM RNA sample prep kit (Illumina, California, USA). The sample was purified and ligated to the genomic adapters provided by Illumina. The purified samples were amplified by 15-cycle PCR. After ligation, the sample was loaded on a 2% agarose E-gel (Invitrogen). The targeted fragments were excised from the gel and purified using Certified Low Range Ultra Agarose (Bio-Rad). The sample was quantified using TBS380 Picogreen (Invitrogen). Sequencing was carried out on the Illumina HiSeq 2000 platform (Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China).
7
Pneumococcal Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNeasy Blood & Tissue Kit (Qiagen) was used to extract genomic DNA from pneumococcal cells cultured overnight following the manufacturer’s guidelines. Whole genome sequencing was performed using the Illumina HiSeq 2000 platform consisting of 1 lane 100 bp paired-end reads. Briefly, Covaris S2 was used to fragment all genomic DNA at the temperature of 5.5 to 6 °C for 40 s. The fragmented DNAs were ends repaired, added with dA base and ligated with Illumina indexed adapters. Invitrogen 2% agarose E-gel was used for size selections of the samples. The selected DNA fragments with adapter molecules on both ends underwent ten cycles of PCR for amplification of prepared material. The samples were then diluted to 10 nM and pooled together. The libraries were loaded onto one lane of Illumina HiSeq 2000 flow cell v3 for sequencing. Illumina adapter sequences were trimmed on both ends of the reads which resulted in low quality bases on the 5′ end of the reads. Low quality bases were removed with a quality score filter of ≥ 30 using PRINSEQ version 0.20.3 [28 ].
8
Optimized Library Preparation for Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 1 μg of SCMDA product was fragmented for 30 min according to the KAPA HyperPlus protocol (Roche). The samples then underwent standard library preparation with 15 µM unique dual index adapters (Integrated DNA Technologies) and four cycles of PCR. The entire product of each PTA reaction was used for DNA sequencing library preparation using the KAPA HyperPlus kit without fragmentation. Then, 2.5 µM of unique dual index adapter (Integrated DNA Technologies) was used in the ligation, and 15 cycles of PCR were used in the final amplification. The libraries from SCMDA and PTA were then visualized on a 1% Agarose E-Gel (Invitrogen). Fragments between 400 to 700 base pairs were excised from the gel and recovered using the ZymoClean Gel DNA Recovery Kit (Zymo Research). The final libraries were quantified using the Qubit dsDNA BR Kit (Thermo Fisher) and Agilent 2100 Bioanalyzer (Agilent Technologies) before sequencing on the NovaSEq. 6000 (Illumina).
9
Validating Isoform-Specific PCR Primers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers flanking isoform junctions were designed using Primer3 (primer3.sourceforge.net). The thermodynamic suitability of the primer pairs was verified using the IDT Oligo Analyzer (Integrated DNA Technologies, USA) and in silico PCR was carried out using the UCSC genome browser to ensure primer specificity. Primers were synthesized by Integrated DNA Technologies (USA) and resuspended to 100 μM stock concentration with EB buffer (Qiagen, USA).
To validate the presence of the isoform junctions, a 50 μl PCR reaction was set up using primers flanking the junction under investigation. The reaction consisted of 0.5 μl of Phusion HS II polymerase (1 U; Thermo Scientific), 10 μl of 5x HF buffer, 1.5 μl of DMSO, 1 μl of 10 mM dNTPs, 0.5 ng of cDNA template, 2 μl of forward primer (10 mM; Integrated DNA Technology, USA) and 2 μl of reverse primer (10 mM; Integrated DNA Technologies, USA). Each reaction was topped up to 50 μl with Ultrapure water (Invitrogen, USA). Conditions for PCR amplification were as follows: 98 °C for 1 min then 35 cycles at 98 °C (15 s)/63 °C (15 s)/72 °C (15 s) followed by a final extension for 5 min at 72 °C. For visualization, 10 μl from each PCR reaction was diluted 1:2 with Ultrapure water, loaded onto a 1% Agarose E-gel (Invitrogen, USA) and run for 10 min.
To validate the presence of the isoform junctions, a 50 μl PCR reaction was set up using primers flanking the junction under investigation. The reaction consisted of 0.5 μl of Phusion HS II polymerase (1 U; Thermo Scientific), 10 μl of 5x HF buffer, 1.5 μl of DMSO, 1 μl of 10 mM dNTPs, 0.5 ng of cDNA template, 2 μl of forward primer (10 mM; Integrated DNA Technology, USA) and 2 μl of reverse primer (10 mM; Integrated DNA Technologies, USA). Each reaction was topped up to 50 μl with Ultrapure water (Invitrogen, USA). Conditions for PCR amplification were as follows: 98 °C for 1 min then 35 cycles at 98 °C (15 s)/63 °C (15 s)/72 °C (15 s) followed by a final extension for 5 min at 72 °C. For visualization, 10 μl from each PCR reaction was diluted 1:2 with Ultrapure water, loaded onto a 1% Agarose E-gel (Invitrogen, USA) and run for 10 min.
10
Sequencing of DNA from Blood Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from blood culture broth (sample obtained in January 2014) using the manual extraction Gentra Puregene kit (Qiagen CAT# 158389; Autogen INC, Holliston, MA, USA) and quantified using the NanoDrop spectrophotometer. The quality of subjected DNA sample was determined by loading 150 mg of diluted DNA in 1% agarose E-gel (Invitrogen, Paisley, UK). We have conducted 2 sequencing runs using the Personal Genome Machine (PGM) sequencer from Life Technologies (Thermo Fisher, Carlsbad, CA, USA). Briefly, library was prepared using 50 ng of extracted DNA universal primers and AmpliSeq HiFi mix (Thermo Fisher). The 15-cycle amplification product was subjected to digestion using FuPa reagent (Thermo Fisher) and ligated with universal adapters. Purified barcoded libraries were quantified by real-time polymerase chain reaction (qPCR) and normalized to 100 pM. Then, they were subjected to emulsion polymerase chain reaction (ePCR) using the Ion PGM Template OT2 400 and the Ion OneTouch System. The ePCR template was enriched using the OneTouch ES (Thermo Fisher) to produce Ion Sphere particles ready for sequencing as single-ended read library. The library was then loaded to the Ion 318 Chip (Thermo Fisher) and sequenced using the PGM sequencer. The output of the sequencer is a set of single-ended reads with expected maximum length of 400 bp.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!