The MC4R-deficient rat model was originally developed by an ENU-induced mutation in Wistar Hannover rats, which resulted in a truncated form of the receptor with the inability to be expressed in the plasma membrane 26 (link). The mutation introduced an additional Ddel restriction site (CTNAG) within the MC4R gene. Thus, genotyping was performed using a restriction enzyme-based PCR assay utilizing the primers: Forward: TGATCATGTGTAACGCTGTCAT, Reverse: TGACAAATTCTGCAGGTCTCT to amplify 177 bp fragment of Mc4r gene. The PCR product was subjected to DdeI enzyme restriction and genotyping was performed using Qiagen QIAxcel Advanced capillary electrophoresis system. For wild-type rats, Ddel treated PCR fragment generated 2 bands at 120 and 57 bases and homozygous MC4R deficient rats gave 3 fragments at 106, 56, and 15 (unobserved).
Qiaxcel advanced capillary electrophoresis system
Manufactured by Qiagen
Sourced in Germany
The QIAxcel Advanced is a capillary electrophoresis system designed for the analysis of DNA, RNA, and proteins. It provides automated separation, detection, and analysis of samples.
Automatically generated - may contain errors
Lab products found in correlation
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Veriti, by Thermo Fisher Scientific (1 mentions)
Pfu dna polymerase, by Promega (1 mentions)
Qiaxcel dna screening cartridge, by Qiagen (1 mentions)
Qiaxcel screengel software, by Qiagen (1 mentions)
Gelcompar 2 software, by bioMérieux (1 mentions)
Generead dna ffpe kit, by Qiagen (1 mentions)
Qiaamp dna blood midi kit, by Qiagen (1 mentions)
Miseq system, by Illumina (1 mentions)
6 protocols using qiaxcel advanced capillary electrophoresis system
1
Genotyping of MC4R-deficient Rats
2
PCR Detection of SARS-CoV-2 Genome Deletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the 382-nucleotide deletion in the SARS-CoV-2 genome, we used two specific PCR primers (forward 5ʹ-TGTTAGAGGTACAACAGTACTTT-3ʹ; reverse 5ʹ-GGTAGTAGAAATACCATCTTGGA-3ʹ) flanking the deleted region.5 (link) For samples with high cycle threshold (Ct) values, hemi-nested PCR was done with a second forward primer (5ʹ-TGTTTATAACACTTTGCTTCACA-3ʹ) and the same reverse primer as before. The PCR mixture contained the cDNA primers (10 μM each), 10 × Pfu reaction buffer (Promega, Madison, WI, USA), Pfu DNA polymerase (Promega), and 10 mM dNTP mix (Thermo Scientific, Waltham, MA, USA). PCR was done in a thermal cycler (Applied Biosystems Veriti, Foster City, CA, USA) with the following conditions: 95°C for 2 min, followed by 35 cycles at 95°C for 1 min, 52°C for 30 sec, and 72°C for 1 min; and a final extension at 72°C for 10 min. Deletions in the PCR products were visualised with use of a QIAxcel DNA screening cartridge on QIAxcel Advanced capillary electrophoresis system (Qiagen, Hilden, Germany).
3
Genotyping 99 E. coli Strains via RAPD-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ninety-nine E. coli strains were genotyped by using RAPD (Random[ly] Amplified Polymorphic DNA) PCR, and the amplicons analyzed using the high-resolution Qiaxcel Advanced capillary electrophoresis System (Qiagen). We selected the RAPD technique which, despite certain limitations, is a useful tool to provide initial insights on the genotypic diversity of large numbers of isolates63 (link)64 (link)65 (link). PCR were performed as described by Regua-Mangia et al.66 (link) and Luna et al.3 (link), using 1 μL of bacterial lysate. Amplification products were purified and analysed using Qiaxcel. A dendrogram was obtained by analyzing electrophoretic peaks on Bionumerics v7.0 software (Applied Maths), using the Dice similarity coefficient and UPGMA (Unweighted Pair Group Method of Averages) as clustering method.
4
Genotyping of Vancomycin-Resistant Enterococci using BOX-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of VRE isolates was performed using by BOX-PCR. Prior to analysis, each VRE isolate was streaked onto a Mueller-Hinton (MH) agar plate (Hylabs, Rehovot, Israel) and incubated at 37 °C. BOX-PCR was performed as previously described [17 (link)] with the following modifications. 100 ng of DNA extracted from one colony from each plate was suspended in 7.5 μl sterile ddH2O and added to 10 μl of PCR mastermix (OneTaq®, NEB, UK). 0.5 μl (50 μM) BOX A2R primer was added to obtain a final volume of 18 μl. Samples were denatured at 95 °C for 7 min, amplified in 35 cycles of 90 °C for 30 s, 40 °C for 1 min, and 68 °C for 8 min, followed by a final extension step of 68 °C for 16 min. Banding patterns were visualized using QIAxcel ScreenGel software (Qiagen, USA) combined with the QIAxcel Advanced capillary electrophoresis system (Qiagen, USA). A E. faecium 5842 reference strain was included as a discriminatory control. Fingerprint patterns of the isolates generated by BOX-PCR were analyzed with GelCompar II software (Applied Maths, Belgium). Dendrograms were created using a densitometric curve-based algorithm (Dice correlation coefficient) and UPGMA to cluster patterns by similarity.
5
Efficient FFPE DNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was extracted from two 10-μm section of FFPE tumor samples and 0.5 mL of peripheral blood samples by the GeneRead FFPE DNA Kit (QIAGEN, Hilden, Germany) and the QIAamp DNA Blood Midi Kit (Qiagen, Hilden, Germany), respectively following manufacturer's instructions. The quality of extracted DNA was assessed by QIAxcel Advanced capillary electrophoresis system (QIAGEN, Hilden, Germany), and DNA concentration was measured by the Qubit fluorometer (Thermo Fisher Scientific, Paisley, UK). Samples with a concentration of less than 14 ng/μL and total DNA of less than 100 ng were excluded from this study.
6
Targeted DNA sequencing using HRR panel
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA libraries were prepared using the HRR handle panel (32 genes, Amoy dx) according to the manufacturer's instructions. The quality of the libraries was checked out by QIAxcel Advanced capillary electrophoresis system (QIAGEN, Hilden, Germany). The prepared DNA libraries were sequenced on MiSeq System (Illumina, San Diego,) with 2×150 bp paired-end reads and a median coverage depth of 1297X.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!