The pcDNA3-HA-p53 plasmid and pcDNA3 negative control empty vector were generously provided by Dr. Marin (Gonzalez-Cano et al., 2013 (link)). The pGPU6/GFP/Neo plasmid used for constructing the p53 short hairpin RNA (shRNA) vector was purchased from GenePharma (China). The p53 shRNA target sequence was TACCACCATCCACTACAACTA and the new plasmid was named Si-p53. A random DNA sequence (Si-control) was used as a negative control. Cells were seeded in six-well plates at 1 × 106/well and incubated overnight. pcDNA3-HA-p53, pcDNA3, Si-p53 and Si-control plasmids were transfected using TurboFect Transfection Reagent (Thermo Scientific) according to the manufacturer’s protocol. After incubation for 48 h at 37°C, cells were harvested and the expression of TAp73 and ΔNp73 was assessed by western blot analysis.
Pgpu6 gfp neo plasmid
Manufactured by GenePharma
Sourced in China
The PGPU6/GFP/Neo plasmid is a versatile genetic tool used in various molecular biology applications. It contains a GFP (green fluorescent protein) reporter gene and a neomycin resistance gene for selection purposes. The plasmid's core function is to facilitate the expression and detection of target genes in transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Pires2 egfp plasmid, by GenScript (2 mentions)
Turbofect transfection reagent, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Geneticin g418, by Merck Group (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 plasmid, by Thermo Fisher Scientific (1 mentions)
Si hcp5 1, by GenePharma (1 mentions)
Mir 205 mimic, by GenePharma (1 mentions)
Si nc, by GenePharma (1 mentions)
Sh nc, by GenePharma (1 mentions)
Eclipse ti fluorescence microscope, by Nikon (1 mentions)
Pex 2 plasmid, by GenePharma (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Antagomir 194 5p, by GenePharma (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Sangon (1 mentions)
12 protocols using pgpu6 gfp neo plasmid
1
Modulating p53 Expression in Cell Lines
2
LINC00339 Knockdown and TWIST1 Overexpression in Glioma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Short-hairpin RNA directed against human LINC00339 was constructed in pGPU6/GFP/Neo plasmid (shLINC00339) (Gene Pharma, Shanghai, China). Human full-length TWIST1 coding sequence (CDS) and with its 3′ UTR sequences were ligated into pIRES2-EGFP plasmid (TWIST1-ORF and TWIST1-ORF-3′ UTR) (GenScript, Piscataway, NJ, USA), respectively. Plasmid carrying a non-targeting sequence was used as a negative control (NC).
Transfection was performed at about 80% confluency of cells (glioma U87 and U251) in 24-well plates using Lipofectamine 3000 Reagents (Life Technologies, Carlsbad, CA, USA). The stably transfected cells were selected by the culture medium containing Geneticin (G418; Sigma-Aldrich, St. Louis, MO, USA). After approximately 4 weeks, G418-resistant cell clones were established. Stable cell lines transfected efficiencies were assessed by qRT-PCR.
Transfection was performed at about 80% confluency of cells (glioma U87 and U251) in 24-well plates using Lipofectamine 3000 Reagents (Life Technologies, Carlsbad, CA, USA). The stably transfected cells were selected by the culture medium containing Geneticin (G418; Sigma-Aldrich, St. Louis, MO, USA). After approximately 4 weeks, G418-resistant cell clones were established. Stable cell lines transfected efficiencies were assessed by qRT-PCR.
3
Knockdown of PPAR-β in Embryonic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse PPAR-β shRNAs (sh-PPAR-β) with the sequences, 5’-GGAGCATCCTCACCGGC-AA-3’ and 5’-GCAGCTGGTCACTGAGCAT-3’ [42 (link)] were constructed into pGPU6/GFP/Neo plasmid by GenePharm. In the PPAR-β knockdown experiments, these two plasmids were used at a 1:1 ratio. Scrambled shRNA (sh-control) with the sequence 5’-GTTCTCCGAA-CGTGTCACGT-3’ was used as negative control. ES cells were transfected with either sh-PPAR-β plasmid or sh-control plasmid (2 μg/mL) with lipofectamine 2000 according to the manufacturer protocol. GFP expression of ES cells was examined 48 h after transfection. To assess gene silencing, protein level of PPAR-β was determined by western blot 72 h after transfection. Viability and pluripotency of ES cells was also evaluated after transfection with sh-PPAR-β plasmid.
4
Knockdown of TCF4 in HepG-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA constructs targeting TCF4 (shRNA-TCF4-1, CCGGGCAGACATCAATTCCAGTCTTCTCGAGAAGACTGGAATTGATGTCTGCTTTTT; shRNA-TCF4-2, CCGGCGAATTGAAGATCGTTTAGAACTCGAGTTCTAAACGATCTTCAATTCGTTT TT) were inserted into the pGPU6/GFP/Neo plasmid (GenePharma). HepG-2 cells were grown to 80% confluence prior to transfection. In each well, 4 μg of plasmid DNA and 10 μl of Lipofectamine 2000 (Invitrogen) were mixed in Opti-MEM (Gibco) and then added to cells. Medium was replaced 6 h post-transfection. Cells were selected with G418 (800 μg/ml). A non-target plasmid containing an shRNA that does not target human genes was used as a control.
5
Silencing HCP5 in U251 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNAs (siRNAs) against HCP5 (si-HCP5#1, si-HCP5#2, and si-HCP5#3), their negative control (si-NC), miR-205 mimics, and scrambled miRs (NC mimics) were synthesized by GenePharma Co., Ltd. (Shanghai, China). Short hairpin RNA (shRNA) targeting HCP5 (sh-HCP5) and its negative control (sh-NC) were cloned into pGPU6/GFP/Neo plasmid by GenePharma Co., Ltd. Full-length human VEGF-A gene was ligated into pcDNA3.1 plasmid (Invitrogen, Carlsbad, CA, USA), with empty pcDNA3.1 vector as a control (pcDNA3.1). These vectors were transfected into U251 cells using Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. Transfected cells were collected at 48 h after transfection to do the downstream experiments.
6
Stable Knockdown of IGFL2-AS1 Using shRNA Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA plasmids used in this study were constructed using the pGPU6/GFP/Neo plasmid (GenePharma, Shanghai, China). The targeting sequences were 5′-GCA TCA CGC TTG ACC CAT T-3′ (sh-IGFL2-AS1) for the human IGFL2-AS1 transcript and 5′-TTC TCC GAA CGT GTC ACG T-3′ (sh-NC) for the non-targeting control [8 (link)]. Plasmids were transiently transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, after which stably expressing cells were selected by culturing in the presence of the neomycin analog, G418. Cells were incubated for 14 days, with the replacement of G418-containing medium every 3 days. After 2 weeks, green fluorescent protein (GFP)-positive clones were isolated and maintained in the presence of G418. Fluorescence images were obtained using an Eclipse Ti fluorescence microscope (Nikon, Tokyo, Japan).
7
Overexpression and Knockdown of HULC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length HULC sequences were ligated into pEX-2 plasmid (GenePharma, China) and the resultant plasmid was referred to as pEX-HULC. For HULC knockdown, short-hairpin RNA targeting human HULC was sub-cloned into pGPU6/GFP/Neo plasmid (GenePharma) and the resultant plasmid was referred to as sh-HULC. The pGPU6/GFP/Neo plasmid carrying a non-targeting sequence was referred to as sh-NC, acting as the negative control of sh-HULC. Cell transfection was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. Stably transfected cells were generated by transfection of pEX-HULC, pEX-2, sh-HULC or sh-NC, followed by sequential selection with 0.5 mg/mL G418 (Sigma-Aldrich, USA).
8
Overexpression and Silencing of ERp29 in CRC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ERp29 cDNA was cloned into the GV492 vector which was transfected into CRC cells using lipofectamine2000 (Invitrogen, California, USA), according to the manufacturer’s instructions. ERp29 shRNA cloned into pGPU6-GFP-Neo plasmid (Gene Pharma, Shanghai, China) was used for silence of ERp29 in CRC cells. 100 pmol of miR-135a-5p mimics were used to overexpress miR-135a-5p, with NC-mimics as negative control. Cells were harvested at 24 h or 48 h after transfection for extracting total RNA or protein.
9
Plasmid-mediated Modulation of circ-USP1, lin-USP1, and FLI1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The short‐hairpin circ‐USP1 (circ‐USP1 (−)), linear USP1 (lin‐USP1 (−)) and FLI1 (FLI1 (−)) plasmids, and their respective negative control (NC), the non‐targeting sequence, were ligated into a pGPU6/GFP/Neo plasmid (GenePharma). FLI1 full length (FLI1 (+)) vector and its respective NC were reconstructed into a pIRES2‐EGFP plasmid (GenScript). AgomiR‐194‐5p (miR‐194‐5p (+)), antagomiR‐194‐5p (miR‐194‐5p (−)) and their corresponding NC were synthesized (GenePharma).
ECs were transfected with Lipofectamine LTX and Plus reagent (Life Technologies). G418 was used to select the stably transfected cells. The sequences for shRNA targeting circ‐USP1, FLI1 and NC were showed in TableS2 .
ECs were transfected with Lipofectamine LTX and Plus reagent (Life Technologies). G418 was used to select the stably transfected cells. The sequences for shRNA targeting circ‐USP1, FLI1 and NC were showed in Table
10
Optimizing CXCR4 and EGFR Silencing in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNAs targeting CXCR4 or EGFR (Shanghai GenePharma Co., Ltd., Shanghai, China), driven by a U6 promoter, were cloned into pGPU6/GFP/Neo plasmids (Shanghai GenePharma Co., Ltd.). The sense sequences used for the targeted silencing of CXCR4 were as follows: shRNA #1, 5′-GTATGACAACAGCCTCAAG-3′; shRNA #2, 5′-GAAGCATGACGGACAAGTA-3′. The sense sequences for targeting EGFR were as follows: shRNA #1, 5′-CGCAAAGTGTGTAACGGAATA-3′; shRNA #2, 5′-CTGACTCCGTCCAGTATTGAT-3′. Empty vector-transfected MDA-MB-231 cells were used as the negative control. The day prior to transfection, 5×105 MDA-MB-231 cells were inoculated into each well of a 6-well culture plate. For transfection, 8 µg shRNA plasmid was combined with 10 µl Lipofectamineä 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's protocol, and added to the cells (19 (link)). After 6 h, cells were supplied with 3 ml/well RPMI-1640 supplemented with 10% FBS. Selection commenced at 48 h following infection; shCXCR4 cells were treated with 2 µg/ml puromycin (Sangon Biotech, Shanghai, China) and shEGFR cells were treated with 1,000 µg/ml geneticin (G418; Sangon Biotech) (3 (link)). The cells that were infected with shRNAs targeting CXCR4 and EGFR were selected with puromycin or G418 simultaneously for ~2 weeks.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!