Total RNAs were extracted from the indicated samples using TRIzol reagent (Invitrogen, Waltham, MA, USA) and treated with DNase I (Dnase-free kit, Invitrogen) to remove residual genomic DNA. Then, the RNA (2.5 µg) from each sample was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan) according to the manufacturer’s protocol. RT-qPCR was performed with SYBR green master mix (TaKaRa) on LightCycler@96 Real-Time PCR system (Roche, Basel, Switzerland), and specific forward and reverse primers sequences were listed in Supplementary Table S1 . Relative gene expression was analyzed using the 2−ΔΔCt method, and housekeeping gene Arbp was used as an internal control. This method was used for analyzing data in Figure 1 b, Figure 2 c, and Figure 4 m.
Dnase free kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The DNase-free kit is a laboratory product designed to remove DNase enzymes from samples. DNase enzymes can degrade DNA and interfere with downstream applications. The kit provides a simple and effective method to eliminate DNase activity, allowing for the preservation of DNA integrity in various research and analytical procedures.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Superscript vilo kit, by Thermo Fisher Scientific (3 mentions)
Sybr green containing mastermix, by Primerdesign (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Oligo dt primer, by Promega (2 mentions)
Rotor gene q 5plex hrm platform, by Qiagen (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Rna stat 60, by Tel-Test (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanovue, by GE Healthcare (2 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr green master mix, by Takara Bio (1 mentions)
Lightcycler 96 real time pcr system, by Roche (1 mentions)
High capacity cdna reverse transcription, by Thermo Fisher Scientific (1 mentions)
Superscript 3 platinum two step qpcr kit with sybr green, by Thermo Fisher Scientific (1 mentions)
Rneasy midi kit, by Qiagen (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
19 protocols using dnase free kit
1
Reverse Transcription and qPCR Quantification
2
Comprehensive Mouse Testis RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction from the whole mouse testes and qPCR setup were performed as described previously [60] (link). Briefly, 2.5 µg of total RNA from each sample was treated with DNase I to remove residual genomic DNA (DNase-free kit, Invitrogen), and then subject to reverse transcription into first-strand cDNA using a combination of oligo (dT) and random primers. The complement RNA strand was removed by incubation with RNase H enzyme at 37°C for 20 min. For qPCR reaction, 25 ng cDNA was loaded as template in every 20 µl reaction volume for each sample with a 40 amplification cycles. Data were acquired in biological triplicates. Relative gene expression was calculated based on ΔΔCt method using Gapdh as an internal control. All primers sequences were listed in Table S7 .
3
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from uninduced and induced i293-ST cells using TRIzol (Invitrogen) (88 (link)). The RNA was DNase treated using the Ambion DNase-free kit according to the manufacturer's instructions, and RNA (1 μg) from each fraction was reverse transcribed with SuperScript II (Invitrogen) according to the manufacturer's instructions, using oligo(dT) primers (Promega). Ten nanograms of cDNA was used as the template in SensiMixPlus SYBR qPCRs (Quantace) according to the manufacturer's instructions, using a Rotor-Gene Q 5plex HRM platform (Qiagen) with a standard 3-step melting program (95°C for 15 s, 60°C for 30 s, and 72°C for 20 s), as previously described (89 (link)). With GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal control mRNA, quantitative analysis was performed using the comparative ΔΔCT method, as previously described (90 (link)).
4
Quantitative RT-qPCR for mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol (Invitrogen) and DNase treated using the Ambion DNase-free kit, as per the manufacturer’s instructions, before RNA (1μg) from each fraction was reverse transcribed with SuperScript II (Invitrogen), as per the manufacturer’s instructions, using oligo(dT) primers (Promega). 10ng of cDNA was used as template in SensiMixPlus SYBR qPCR reactions (Quantace), as per manufacturer’s instructions, using a Rotor-Gene Q 5plex HRM Platform (Qiagen), with a standard 3-step melt program (95 °C for 15 seconds, 60 °C for 30 seconds, 72 °C for 20 seconds) as previously described [107 (link)]. With GAPDH as internal control mRNA, quantitative analysis was performed using the comparative ΔΔCt method as previously described [108 (link)].
5
LMNA Splicing Analysis in Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from fibroblasts from an unaffected and affected subject using RNA STAT-60 (Tel-Test Inc). A total of 20 μg RNA was DNaseI treated (30 minutes at 37°C) using the DNase-free kit from Ambion. Complementary DNA (cDNA) was synthesized from RNA at 25°C for 10 minutes; 48°C for 30 minutes followed by 95°C for 5 minutes using the reverse transcription kit from ABI. To determine the effect of LMNA c.1045C>T in inducing alternate splicing, cDNA was amplified with primers located in exons 5 and 7 (F1 5’-GGCAGTCTGCTGAGAGGAAC-3’ plus R1 5’- ACAAACTTGCCCTCCTCATC-3’). cDNA was amplified using a touchdown polymerase chain reaction protocol as follows: 98°C for 5 minutes followed by 20 cycles at 96°C for 30 seconds, 65°C for 30 seconds with a 0.5°C decrease each cycle, 72°C for 30 seconds and an additional 20 cycles at 96°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. The amplified products were analyzed on 1.2% agarose gel and visualized with ethidium bromide. The DNA fragment was of the expected 532–base pair size.
6
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and cDNA synthesis were performed according to Silveira and collaborators4 (link). Briefly, total RNA was extracted from samples using TRIZOL Reagent (Thermo Fisher Scientific, USA), following the manufacturer's instructions. RNA was treated with the DNAse-free kit (Ambion, USA) to remove genomic DNA contamination. Subsequently, RNA concentration and purity were measured using a NanoVue Plus spectrophotometer (GE Healthcare Life Science, USA) and after, the samples were stored at − 80 °C. Complementary DNA (cDNA) was obtained using High Capacity cDNA Reverse Transcription (Applied Biosystems, USA) according to the manufacturer's recommendation at a concentration of 500 ng. Finally, cDNA was stored at − 20 °C until use.
7
Quantifying Innate Immunity Genes in NEC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR (RT-qPCR) analysis was performed on ileal samples of all pigs to evaluate for expression of the following genes involved in innate immunity and implicated in NEC development: IL1-β, IL-6, S100A9, TLR-4, TNFα. Total RNA was isolated using the RNeasy Midi kit (Qiagen) and was DNAse-treated using the DNase-free kit from Ambion (#AM1906). The DNAse-treated RNA was used for the reverse transcription reactions using the High Capacity cDNA Reverse Transcription kit (Applied Biosystem), and cDNA products were stored at 4°C until RT-qPCR was performed using Superscript III Platinum Two-Step qPCR kit with SYBR Green (Invitrogen) on Bio Rad CFX96 real-time PCR machines. Oligonucleotide primer sequences were designed using NCBI Primer Blast (Table S2
8
RT-qPCR Analysis of Mouse Liver Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse livers (100–200 mg) using RNA STAT-60 (Tel-Test, Friendswood, TX). Total RNA, in equal quantity, was pooled from six livers of each genotype and sex, and RT-qPCR was carried out in a 20 µL reaction volume. A total of 20 µg RNA was DNase I treated using the DNase-free kit from Ambion (Grand Island, NY). Complementary DNA was made using 2 µg DNase I-treated RNA using reverse-transcription kit from ABI (Carlsbad, CA). RT-qPCR was performed in duplicate using 2.5 µM primers, 20 ng complementary DNA, and SYBR Green. All RT-qPCR were carried out in 96-well plates using the StepOnePlus real-time polymerase chain reaction system (Applied Biosystems, Foster City, CA). RT-qPCR was performed three times and in duplicate, and the transcript levels were normalized to cyclophilin. The ΔCt value for each sample was calculated as ΔCt = [Ct (gene of interest) − Ct (cyclophilin)]. The ΔΔCt value for each gene of interest was calculated as ΔΔCt = [ΔCt (Agpat2−/−) − ΔCt (WT)]. The fold change was calculated as fold change = 2−ΔΔCt. Primers used for gene amplification were obtained from Harvard primer bank [22 (link)–24 (link)] and Integrated DNA Technologies (Coralville, IA). Primers used are listed in Table 1 .
9
qPCR Analysis of Small GTPases in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from cells using RNeasy Mini Kits (Qiagen). Contaminating DNA was used with a DNase-free kit (Ambion). For complementary DNA (cDNA) synthesis, a SuperScript VILO Kit was used (Invitrogen). qPCR was carried out with cDNA using SYBR Green-containing Master Mix (Primer Design). GADPH was used as a reference gene. The qPCR oligonucleotide primers used for RhoH were as follows: F, GAGAAGTAACATTCTGCAAATCGC R, AGCACACGCCATTCAGCAAG; for Rac2: F, GCAAGACCTGCCTTCTCATCA R, GCTGTCCACCATCACATTGG; for RhoA: F, CAACTATGATTATTAACGATGTCCAACC R, TGGTGTGTCAGGTGGGAGTG; and for GAPDH: F, GTGAAGGTCGGAGTCAACG R, TGAGGTCAATGAAGGGGTC.
10
Extraction and RT-PCR Analysis of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed from primary tumours and cell lines using Trizol reagent (Invitrogen, Grand Island, NY, USA) as per the manufacture's instruction and later resolved on 1.2% agarose gel to confirm the RNA integrity. DNase treatment was done using the DNase Free kit (Ambion, Foster City, CA, USA; cat AM1906) followed by first-strand cDNA synthesis taking 2 μg of total RNA using Superscript III kit (Invitrogen, 18080-051). E6 (HPV-16) and GAPDH expression were checked as described previously (Smeets et al, 2007 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!