Construction of the E1 bait proteins was described previously (55 (link)). Briefly, PCR-amplified fragments of the E1 open reading frame were inserted into the pAS1 plasmid containing the DNA-binding domain of GAL4. The baits were screened against a human lymphocyte cDNA library cloned into the pACT2 vector backbone containing the activation domain of GAL4. The yeast two-hybrid screening procedure has been described previously (55 (link)). For the GST pull-down assay, DNA sequences coding for the E1 amino acid sequences from position 353 to 649 and position 191 to 649 were GST tagged, inserted into the pFASTBAC1 expression vector (Thermo Fisher Scientific), expressed, and purified as previously described (63 (link)). The BLM, E2, and luciferase proteins used in GST pull-down assays were generated by in vitro transcription-translation using a TnT quick-coupled transcription/translation system (Promega). The T7 promoter-driven plasmids used for in vitro transcription-translation were generated as previously described (55 (link)), while the plasmid for luciferase was included in the kit. The pull-down assay was performed as previously described (55 (link)).
Pfastbac1 expression vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PFastBac1 expression vector is a baculovirus-based system used for the high-level expression of recombinant proteins in insect cells. The vector contains an expression cassette with a polyhedrin promoter for efficient protein production, as well as selection markers and other genetic elements necessary for baculovirus propagation and protein expression.
Automatically generated - may contain errors
Lab products found in correlation
Bac to bac baculovirus expression system, by Thermo Fisher Scientific (3 mentions)
In fusion cloning, by Takara Bio (2 mentions)
Tnt quick coupled transcription translation system, by Promega (1 mentions)
Anti hbc antibody, by Agilent Technologies (1 mentions)
Geneart, by Thermo Fisher Scientific (1 mentions)
Transfection reagent, by Thermo Fisher Scientific (1 mentions)
Tni cells, by Expression Systems (1 mentions)
Psuper rnai system, by Oligoengine (1 mentions)
Top10 chemically competent cells, by Thermo Fisher Scientific (1 mentions)
Geneart ag, by Thermo Fisher Scientific (1 mentions)
Escherichia coli top 10 chemically competent cells, by Thermo Fisher Scientific (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
11 protocols using pfastbac1 expression vector
1
Yeast Two-Hybrid Screening for E1 Protein Interactors
2
Production and Purification of HBc Capsids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length WT HBc and various HBc mutants S1A to S7A were cloned into pFastBac1 expression vector at EcoRI and NotI restriction sites (Thermo Fisher Scientific, Waltham, MA, USA). All mutants were confirmed by DNA sequencing. Spodoptera frugiperda 9 (Sf9) cells were purchased from BCRC (Bioresource Collection and Research Center, Taiwan; ATCC number: CRL-1711)88 (link). and were grown at 28 °C in Protein-Free Insect Cell Culture Medium ESF 921 (Expression Systems, Davis, CA, USA). The recombinant baculoviruses containing various HBc mutants were generated with the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific, Waltham, MA, USA), and amplified in Sf9 insect cells as described89 (link). The supernatants were harvested 3 days post-infection. HBc capsid-containing media were pelleted through a 20% sucrose cushion in 1X Tris-buffered saline (TBS) (0.1 M NaCl, 2 mM KCl, 25 mM Tris pH 7.4) at 26,000 rpm for 18 hr (SW28, Beckman). For further purification, HBc capsids were loaded on a continous 40–70% sucrose gradient at 26,000 rpm for 18 hr (SW28, Beckman). Fractions were collected and analyzed by Western blot with anti-HBc antibody (DAKO, Glostrup, Denmark). HBc-containing fractions were then pooled together, and concentraed through a 20% sucrose chusion at 26,000 rpm for 16–18 hr (SW28, Beckman). The HBc capsid pelletes were resolved in 1X TBS.
3
Cloning and Isolation of HzTransib Transposase
4
Cloning and Isolation of HzTransib Transposase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full length or an N-terminal truncated fragment (residues 17–507) of HzTransib transposase fused to a C-terminal His6 tag or an N-terminal maltose-binding protein (MBP) tag were cloned into pFastBac1 expression vector (ThermoFisher Scientific) between BamHI and HindIII restrictive sites. pB-5’/3’TIR, a derivative of pBR322 containing the TIR substrate for ProtoRAG transposases, was described previously33 (link). To generate TIR substrate for HzTransib transposases, the ProtoRAG 5’TIR and 3’TIR of pB-5’/3’TIR were substituted by the first 51 bp and 50 bp of HzTransib transposon 5’TIR and 3’TIR, respectively, using In-Fusion cloning (Clontech). The PCR amplified and linearized HzTransib substrate contains a HzTransib 5’TIR and 3’TIR separated by 411 bp between their tips, 126 bp of DNA flanking 5’TIR and 276 bp of DNA flanking 3’TIR. The whole substrate was depleted of 5’-CAC-3’ sequence instances except for those contained in 5’TIR and 3’TIR regions.
5
Multivalent M2/NP Epitope Insertion in NoV VP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene sequence of full-length NoV VP1 capsid protein (the GII.4 NoV 2012 pandemic variant Hu/GII.4/Sydney/NSW0514/2012/AU) was modified by inserting influenza virus multivalent M2/NP epitope SLLTEVETPIRNEWGCR CNDSSDSLLTEVETPIRNEWGCRCN GSSDSLLTEVETPTRSEWEC RCSDSSDSLLTEVETPTRNEWECRC SDSSDASNENIETML PFEKS TVM between amino acids 293–297 (loop 1), 371–374 (loop 2), or 391–394 (loop 3) or into all three loops (positive control). The codon-optimized (for insect expression) genes encoding for NoV-M2/NP recombinant proteins and empty NoV platform were synthesized (GeneArt, Thermo Fisher Scientific, Waltham, USA). Synthetic genes were cloned into the EcoRI and BamHI restriction enzyme recognition sites present in the multiple cloning site downstream of the polyhedrin promoter of the pFastBac1 expression vector (Invitrogen).
Recombinant NoV-M2/NP bacmids were generated using a Bac-to-Bac baculovirus expression system (Invitrogen, Waltham, USA). E. coli DH10-Bac competent cells were transformed with recombinant pFastBac1 vectors to generate recombinant bacmid DNA. Homologous recombination of the gene of interest into the bacmid was confirmed by PCR according to the manufacturer’s protocol. Recombinant bacmids were purified and transfected into Sf9 cells. After 6 days, recombinant baculoviruses were harvested, amplified, and titrated.
Recombinant NoV-M2/NP bacmids were generated using a Bac-to-Bac baculovirus expression system (Invitrogen, Waltham, USA). E. coli DH10-Bac competent cells were transformed with recombinant pFastBac1 vectors to generate recombinant bacmid DNA. Homologous recombination of the gene of interest into the bacmid was confirmed by PCR according to the manufacturer’s protocol. Recombinant bacmids were purified and transfected into Sf9 cells. After 6 days, recombinant baculoviruses were harvested, amplified, and titrated.
6
Genetic Engineering of Protein Expression Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pFastBac1 expression vector (Invitrogen) was used to construct plasmids expressing TOP2A-N, TOP2A-C, or full-length PTEN in SF9 insect cells. The N-terminal truncated TOP2A includes amino acids 1–705 and C-terminal truncated TOP2A includes amino acids 668–1531. pET28a (+) plasmid was used for the PTEN N-terminal domain, PTEN C-terminal domain, or control proteins with His-tag. N-terminal PTEN included amino acids 1-189, and C-terminal PTEN included amino acids 190–403. Exogenous OTUD3 was overexpressed in an S-HA tagged vector. An S-protein-HA tag was fused to the N-terminal of exogenously expressed OTUD360 (link). Expression vectors containing FLAG-HA epitope tags were a gift from Dr. W. Gu at Columbia University. DsiRNAs were ordered from IDT with sequences GCCCGCGCUUUUAACCU and AGGCCAUGUCCCGAAGC. The CRISPR plasmids used for the construction HCT116 TOP2A+/− cells targeting exon 4 of TOP2A with the sequence GTGGGTTTACGATGAAGATGT were gifts from Dr. Xi at Peking University and the procedure was carried out as previously described61 (link). The CRISPR targeting sequence used for the construction of PTEN+/− mice was CCAGACATGACAGCCATCATCAAAG in PTEN exon 1, and the procedure used for CRISPR/Cas-mediated genomic engineering to generate mice carrying mutations was carried out with reference to the work of Wang et al.62 (link).
7
Reconstitution of Human Replication Machinery
8
Recombinant PxJHE Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full‐length cDNA sequence of the PxJHE gene with His‐tag was cloned into the pFastBac1 expression vector (Invitrogen). 2 mL Sf9 cells (0.5 × 106 mL−1) were seeded into a 6‐well plate and incubated at 27 °C in an incubator for cell adhesion. 5 µg pFastBac1 vector was transfected into adherent Sf9 cells using transfection reagent (Thermo Fisher Scientific), and Sf9 cells were cultured in an incubator at 27 °C until the cells were transfected. The cells were centrifuged to obtain the P1 generation virus in the supernatant. The supernatant was added to 30 mL Sf9 cells (2.0 × 106 mL−1), and the cells were cultured in a shaker at 120 rpm at 27 °C to obtain the P2 generation virus for expanding the virus population. The P2 generation virus was obtained by centrifuging. The P2 generation virus was added to 1 L Sf9 cells (2.0 × 106 mL−1), and the cells were cultured in shaker at 120 rpm at 27 °C to amplify protein expression. The sample was centrifuged to obtain supernatant, and the proteins were purified using Ni‐column (Yuanye Biotech), and the protein purity was verified with SDS‐PAGE followed by Coomassie staining and western blot (Figure S4 , Supporting Information).
9
Recombinant Telomere Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human TRF1 (NP_059523.2), TRF2 (XP_005256180.1), RAP1 (NP_061848.2), TIN2 (NP_036593.2), TPP1 (AAX82621.1), and POT1 (NP_056265.2) cDNAs were individually cloned into the pFastBac1 expression vector (Invitrogen). The TRF1, TRF2, and RAP1 constructs have N-terminal hexa-histidine (6XHis) tags while TIN2, TPP1, and POT1 have PreScission-cleavable N-terminal 6XHis-MBP tags. The expression vectors were used to make recombinant baculoviruses based on the protocol established in the Bac-to-Bac Baculovirus Expression System (Invitrogen). The baculovirus stocks were titered by gp64 detection using flow cytometry analysis (Expression Systems). Yield-optimized amounts of baculoviruses were used to infect 2–4 liters of Tni cells (Expression Systems) at a cell density of 1.5–2.0 × 106 cells ml−1. The infected cells were then incubated in a shaker for 66–72 h (27 °C, 130 rpm) before they were collected. The collected cells were either immediately used for protein purification or snap-frozen using liquid nitrogen for later purification.
10
Generating Plasmid Constructs for RNAi and Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pSUPER RNAi system (Oligoengine Inc.) was used to construct PTEN-specific shRNA expression plasmids and scrambled control shRNA. APC3 and CENP-C siRNAs were purchased from GE Pharmacon. The expression vectors containing FLAG or FLAG-HA tags were gifts from W. Gu51 (link). The EG5 expression plasmid was created by ligating the full-length coding region of human EG5 into the expression vector with an N-terminal FLAG tag. The EG5 mutants, EG5T926D and EG5T926A, as well as the nuclear-exclusive PTEN mutant, PTENK13E;K289E, were generated using the QuikChange site-directed mutagenesis kit (Strategene) according to the manufacturer's protocol. Wild-type PTEN and phosphatase-deficient PTEN mutants, PTENC124S and PTENG129E, have been described previously4 (link). A pFastBac1 expression vector (Invitrogen) was used to construct plasmids expressing FLAG-tagged EG5, His-tagged wild-type as well as mutant PTEN proteins.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!