Bacterial dna extraction kit

DNA-binding activities of GHc or GHd were investigated by DNA gel retardation (Pan et al., 2018 (link)). In order to extract enough DNAs to identify on agarose gel electrophoresis, the high concentration of bacterial inoculation was used. S. mutans in the exponential phase was diluted to 1 × 10⁹ CFU/ml in 0.9% NaCl. Total DNA was extracted from S. mutans by using a bacterial DNA extraction kit (Sangon Biotech Co., Ltd., Shanghai, China). The concentration and purity of the extracted DNA were evaluated with an optical density ratio of 260–280 nm. The extracted DNA was dissolved in 50 μl of citrate-EDTA buffer (pH 9.0) at a final concentration of 3 mg/ml. Five microliters of the extracted DNA (3 mg/ml) were mixed with the same volume of different concentrations of GHc or GHd (final concentrations of 0.125, 0.25, 0.5, and 1 mM) at 37°C for 30 min. The mixture was evaluated by electrophoresis using a 0.8% agarose gel, and the migrated DNA was visualized by a Gel imaging system (Bio-Rad, Hercules, USA).

According to the manufacturer’s instructions, genomic DNA was extracted from each V. parahaemolyticus isolate using a bacterial DNA extraction kit (Sangon, Shanghai, China).
The toxR gene is important and appears to be well conserved among V. parahaemolyticus isolates. The primers were as follows F: GTCTTCTGACGCAATCGTTG, R: ATACGAGTGGTTGCTGTCATG (Kim et al., 1999 (link)). The tdh and trh genes detection was executed as previously reported (West et al., 2013 (link)). The following primers were used: Tdh-F:CTGTCCCTTTTCCTGCCCCCG, Tdh-R:AGCCAGACACCGCTGCCATTG;Trh-F:ACCTTTTCCTTCTCCWGGKTCSG,Trh-F:CCGCTCTCATATGCYTCGACAKT). All the oligonucleotide primers were synthesized by Sangon Biotech (Shanghai, China). The PCR reaction system contained DNA template (1 μL), 0.5 μM of each primer, 12.5 μL of :2 × PCR mix (Qiagen), and ddH₂O (9.5 μL). The amplified thermal-cycling program was set with the following conditions: denaturation at 95°C (5 min); 40 cycles of 95°C for 1 min, 62°C for 1 min, and 72°C for 1 min; and a final extension step of 72°C for 5 min. PCR amplicons were electrophoresed on 2.0% (wt/vol) agarose gels containing GoldView. The images were captured digitally and analyzed using a gel imaging system. V. parahaemolyticus strains ATCC33847 (tdh+) and ATCC17802 (trh+) were used as positive controls, and distilled water was used as a negative control.

Polymerase chain reaction (PCR) was used to detect the highly conserved species-specific gene toxR and the virulence genes tdh and trh in all V. parahaemolyticus isolates (Law et al., 2017 (link)). Genomic DNA was extracted using a bacterial DNA extraction kit (Sangon, Shanghai, China) according to the manufacturer’s instructions. The primers used to detect toxR, tdh and trh are shown in Table 1. Each PCR amplification reaction was performed in a 25 μL mixture containing 250 ng of DNA as the template, 400 nM each primer, 200 mM each deoxynucleotide triphosphate (dNTP), 10 × PCR buffer, and 5 U of Ex-Taq DNA polymerase (Takara-Bio, Beijing, China). PCR amplification was initiated by incubating the reaction mixture at 94°C for 1 min, followed by 30 cycles at 98°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and a final extension at 72°C for 10 min (Jiang et al., 2019 (link)). PCR products (5 μL) were mixed with 1 μL of 6 × loading buffer dye and analyzed by electrophoresis on a 1.2% agarose gel containing GoldView (Sangon, Shanghai, China). V. parahaemolyticus isolates ATCC33847 (tdh⁺ and trh^–) and ATCC17802 (tdh^– and trh⁺) were used as positive control isolates, and distilled water was used as the negative control.