The largest database of trusted experimental protocols

Pcdh ef1 mcs t2a puro vector

Manufactured by System Biosciences
Sourced in United States

The PCDH-EF1-MCS-T2A-Puro vector is a plasmid construct designed for gene expression studies. It contains the Protocadherin (PCDH) promoter, an enhanced multiple cloning site (MCS), a T2A self-cleaving peptide, and a puromycin resistance cassette. This vector can be used for the stable expression of genes of interest in mammalian cell lines.

Automatically generated - may contain errors

2 protocols using pcdh ef1 mcs t2a puro vector

1

Construction of Doxycycline-Inducible Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Complementary DNAs of CKMT1 and CDK4 were inserted into the pCDH-EF1-MCS-T2A-Puro vector with 3 × Flag at the N-terminus (System Bioscience, Palo Alto, CA, USA), and short hairpin RNAs (shRNAs) targeting CKMT1 (CKMT1-sh1: CGTGGAATTTGGCACAACAAT and CKMT1-sh2: CGGTGTCTTTGATATTTCTAA) and negative control shRNA (shNC: CAACAAGATGAAGAGCACCAA) were cloned into a pLKO.1 vector (Sigma-Aldrich, St. Louis, MO, USA). The doxycycline-inducible lung cancer cell lines were constructed using Tet-on inducible expression system following the manufacturer’s instructions. These plasmids were then packaged in 293 T cells to obtain recombinant lentiviruses with a Lentiviral Packaging Kit (FulenGen). Following a 48 h period of infection with lentivirus plus 5 mg/ml Polybrene, stably overexpression or knockdown cell lines were selected with 3 μg/mL puromycin for 3 days as previously described [20 (link), 21 (link)].
+ Open protocol
+ Expand
2

Lentiviral Transduction of NPM1-ALK in Ba/F3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
As described in our previous study (12 (link)), full-length human NPM1-ALK cDNA (a gift from Dr. Toshiki Watanabe, The University of Tokyo, Japan) was amplified by PCR. The PCR product was then subcloned between XbaI and NheI restriction sites into the lentiviral plasmid pCDH-EF1-MCS-T2A-Puro vector (purchased from System Biosciences, Palo Alto, CA, USA). The clones were confirmed through Sanger DNA sequencing. The lentiviral plasmids, either empty vector pCDH-EF1-MCS-T2A-Puro or recombinant plasmid with FLAG (FG) tag, pCDH-EF1-FG-NPM1-ALK were transfected along with packaging and envelop plasmids psPAX2 and pMD2.G into HEK293T cells. The empty vector or pCDH-EF1-FG-NPM1-ALK lentiviral particles were transduced into Ba/F3 cells and stable clones were selected with puromycin. The Ba/F3-pCDH-vector cell growth was IL3-dependent while the transformed Ba/F3-FG-NPM1-ALK exhibited IL3-independent growth. The NPM1-ALK fusion gene mRNA expression levels were confirmed by RT-qPCR and protein levels were determined by Western blot using FLAG and NPM1-ALK antibodies.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!