Zeb1 antibody

Chromatin immunoprecipitation (CHIP) assays were performed using CHIP Assay Kit (56383S, Cell Signal Technology, USA) according to the manufacturer's protocol. ELF3 antibody were purchase from Santa Cruz Biotechnology (sc-376055, USA); ZEB1 antibody were purchase from Santa Cruz Biotechnology (sc-25388, USA). Briefly, SGC7901 cells were collected and fixed for 10 min at 37°C with 1% formaldehyde, followed in sequence with SDS lysis and DNA shearing, protein and DNA immunoprecipitation, cross-linked DNA reversal and DNA purification, and finally the immunoprecipitated DNA fragments were detected by PCR assays. The normal rabbit IgG was used as the negative control. The sequence of primers for CHIP (anti-ELF3) were used as follows (forward: TCTGAACTCCCAGTCGCTTC; reverse: TATGACACTCCG CGTTTCTG); the sequence of primers for CHIP (anti-ZEB1) were used as follows (forward: CGGGCGGATGCGAAGGCT; reverse: GGGCGCCTGGCTCTACCCAA).

Lung tissues or cultured cells were homogenized and Western blot was performed as previously described [22 (link)]. Briefly, 20–30 μg of total protein was separated on 10% SDS-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Immobilon-P; Millipore Corporation, Billerica, MA). The membranes were then blocked with 5% nonfat milk in PBST (PBS + 0.1% Tween-20) for 20 min and incubated with primary antibody overnight at 4°C. After washing with PBST, the membranes were probed with horseradish peroxidase-conjugated secondary antibody for 2 hrs. Protein bands were visualized with the ECL substrate (Millipore) and scanned using Photoshop. The densitometry unit of the protein expression was normalized to GAPDH levels. The antibodies for HIF-1α, E-cadherin, N-cadherin, vimentin, α-SMA, phospho-p44/42, total p44/42, phospho-p38, and total p38 MAPK were purchased from Cell Signaling Technology (Beverley, MA). Fibronectin and ZEB1 antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). CD44 antibody was purchased from Abcam (Cambridge, MA, USA).

The expression of mTOR, ZEB1, and ROCK1 was evaluated by immunohistochemical staining of formalin-fixed and paraffin-embedded lung tissue sections, which were cut to a thickness of 4 μm. After deparaffinization in xylene and rehydration using graded alcohol to water, these slides were soaked in Target Retrieval Solution (Dako, Carpenteria, CA, USA), and then placed in a water bath at 97°C for 20 min to enable antigen retrieval. The sections were then immersed for 5 min in distilled water containing 3% hydrogen peroxidase to block endogenous peroxidase activity. The sections were incubated for 30 min with primary antibodies for mTOR, ZEB1, and ROCK1 diluted 1:200, 1:100 and 1:50, respectively. The primary rabbit monoclonal mTOR and ROCK1 antibodies were purchased from Abcam (Cambridge, MA, USA). The primary goat polyclonal ZEB1 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The Dako EnVision⁺ System that contains a horseradish peroxidase-labeled polymer was used along with LSAB®2 (Dako, Carpenteria, CA, USA), a streptavidin-peroxidase conjugate that serves as the secondary antibody. Routinely processed tissue sections of prostate cancer, breast cancer, and thyroid cancer were used as positive staining controls for mTOR, ZEB1, and ROCK1 staining, respectively. Staining without the primary antibody was also performed to verify staining specificity.