Rneasy plus column

Manufactured by Qiagen

Sourced in United States

The RNeasy Plus columns are laboratory equipment designed for the purification of total RNA from a variety of sample types. They utilize a silica-based membrane technology to efficiently bind and purify RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using rneasy plus column

Lung and Airway Sampling in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

To sample the luminal contents of lungs and airways, a sterile, 22-gauge catheter was inserted into exposed tracheal lumen of anesthetized mice. Bronchoalveolar lavage fluid (BALF) was collected from three 0.8-ml aliquots of PBS per mouse and centrifuged. Supernatants were saved. Cell pellets were resuspended in equal volumes of 20-mM bis-Tris (pH 6.0) containing 2 M NaCl. In separate experimental animals, freshly excised lungs were perfused with nuclease-free PBS to remove blood. Each of the 5 lobes was bisected, with one half collected for RNA extraction and the other half collected for protein extraction. Pooled lobe halves from each mouse were snap-frozen in liquid N₂ and stored at -80°C. For RNA extraction, frozen lung was homogenized in Trisure reagent (Bioline USA, Taunton, MA). RNA was purified from the extract via an RNeasy Plus column (Qiagen, Valencia, CA). Genomic DNA was removed by on-column digestion with DNAse I (Qiagen). For protein extraction, lobe halves were homogenized in 1 ml of 20-mM MES (pH 6). After collection by centrifugation at 20,000 x g for 10 min at 4°C, pellets were re-solubilized in 0.25 ml of 20-mM MES (pH 6) containing 2 M NaCl. The resulting supernatants, after centrifugation, were diluted 1:10 in 20-mM MES (pH 6) containing 2 M NaCl and 0.5% Triton X-100 for ELISA.

Raymond W.W., Xu X., Nimishakavi S., Le C., McDonald D.M, & Caughey G.H. (2015). Regulation of Hepatocyte Growth Factor in Mice with Pneumonia by Peptidases and Trans-Alveolar Flux. PLoS ONE, 10(5), e0125797.

+ Open protocol

+ Expand

RNA-seq and small RNA-seq analysis of Cas9 modified cell lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was harvested from stable MB cell lines modified with Cas9 and sgRNAs targeting the promoter. RNA was isolated from cells no later than six passages after antibiotic selection and purified by the Qiagen RNeasy Plus column. RNA integrity was confirmed using the Agilent Bioanalyzer before RNA-seq library preparation. Both RNA-seq and small RNA-seq were performed on the Illumina NovaSEq. 6000 using the protocols of paired-end 150 and single-end 50 reads, respectively. Reads were aligned to the mouse genome mm10 using the spliced-read aligner HISAT2 v2.0.3 with default parameters. Transcript abundance estimation in transcripts per million (TPM) and differential expression analysis were performed using DESeq2 (63 (link)). We identified differentially expressed transcripts with an adjusted P value < 0.1 and further filtered significant genes based on an expression cutoff (TPM > 1) and fold-change threshold (| log2FC | > 1). Differential expression in the small RNA-seq datasets were performed used the small RNA-seq pipeline in Basepair. Sequencing data are deposited at GEO accession number GSE205695 and GSE205691.

Peng K.L., Vasudevan H.N., Lockney D.T., Baum R., Hendrickson R.C., Raleigh D.R, & Schmitt A.M. (2022). Miat and interacting protein Metadherin maintain a stem-like niche to promote medulloblastoma tumorigenesis and treatment resistance. Proceedings of the National Academy of Sciences of the United States of America, 119(37), e2203738119.

+ Open protocol

+ Expand

Lipid Nanoparticle Transfection of PD-L1 siRNA

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lipid nanoparticles (LNPs) for siRNA transfection were formulated by 1,2-dioleoyl-3-trimethylammonium-propane, cholesterol, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (Avanti Polar Lipids), and synthesized using a thin-film rehydration and sonication method. pd-l1 siRNA (Sigma) was encapsulated into LNP by co-incubation in HEPES buffer for 30 minutes at room temperature. MDSCs were lifted and re-plated at 10⁶ cells/mL/well in 24-well plates and were allowed to adhere overnight. MDSCs were incubated with siRNA (pd-l1 or scramble)/LNP complex in Opti-MEM at siRNA concentration of 100 nM for 4 hours at 37 °C. The medium was replaced by complete RPMI and the cells were cultured for 24 hours at 37 °C. RNA was isolated from siRNA treated MDSCs using the RNEasy Plus Mini Kit (Qiagen). Following chloroform extraction, samples were loaded onto RNeasy Plus columns (Qiagen) and processed according to the manufacturer’s protocol. Total RNA was quantified using a Nanodrop apparatus (Thermo Scientific) and then converted to cDNA using the iScript cDNA synthesis kit (Bio-Rad). pd-l1 and control β-actin transcripts were analyzed by using the 2^–ΔΔCT method. Murine pd-l1 primers: forward TGCTGCATAATCAGCTACGG; reverse CCACGGAAATTCTCTGGTTG (18 (link)). Murine β-actin primers: forward TTGCTGACAGGATGCAGAAG; reverse ACATCTGCTGGAAGGTGGAC (19 (link)).

Lee-Chang C., Rashidi A., Miska J., Zhang P., Pituch K.C., Hou D., Xiao T., Fischietti M., Kang S.J., Appin C.L., Horbinski C., Platanias L.C., Lopez-Rosas A., Han Y., Balyasnikova I.V, & Lesniak M.S. (2019). Myeloid-derived suppressive cells promote B cell–mediated immunosuppression via transfer of PD-L1 in glioblastoma. Cancer immunology research, 7(12), 1928-1943.

+ Open protocol

+ Expand

Hypoxia and Inflammation Modulate HBMEC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Passage 8 HBMEC were seeded into culture plates at 62,500 cells/cm² in EGM-MV2 and incubated for up to 48 h at 37 °C and 5% CO₂. Working solutions of CoCl₂, IL-1β, and TNFα prepared in Hank’s balanced salt solution (HBSS) were then added to final concentrations of 100, 200, or 500 μM of CoCl₂ or 100 ng/mL of cytokine, and the cells were cultured for an additional 48 h. Total RNA was then isolated using Qiagen RNeasy Plus columns (Germantown, MD, USA) and real-time PCR performed for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), nitric oxide synthase 3 (eNOS), cytochrome b5 reductase 3 (CYB5R3), or hemoglobin alpha 2 (HBA2) using validated primers and reagents obtained from Qiagen. Following amplification, transcriptional analysis was performed using ΔCt analysis of threshold call differences between GAPDH and targets, or relative expression calculated by ΔΔCt analysis versus diluent controls. For post-treatment detection of NO, some wells were loaded with 5 μM DAF-FM acetate for one hour at room temperature and washed, and NO production was fluorescently measured after 2 h in HBSS using a Nikon Eclipse Ti microscope (Melville, NY, USA).

Thomas G., Banton K.L., Garrett R., Palacio C.H., Acuna D., Madayag R, & Bar-Or D. (2023). Hypoxia Dysregulates the Transcription of Myoendothelial Junction Proteins Involved with Nitric Oxide Production in Brain Endothelial Cells. Biomedicines, 12(1), 75.

+ Open protocol

+ Expand

Isolation and Gene Expression Analysis of Tumor-Infiltrating T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cultured tumor cells were detached and washed with ice-cold PBS. Tumor-infiltrating CD4⁺ and CD8⁺ T cells were enriched by positive selection using Miltenyi MicroBeads Kits with the indicated columns. Cells (T cells or cell lines) were counted and RNA extracted using RNeasy Plus columns (QIAGEN). RNA was quantified by NanoDrop and reverse transcribed using SuperScript IV (Invitrogen); gene expression was quantified in duplicate or triplicate using PowerUp SYBR Green (Applied Biosystems). For miRNA, RNA was isolated by using the Quick-RNA Microprep Kit (Zymo Research), cDNA prepared using the miRCURY LNA RT Kit (QIAGEN), and gene expression quantified in duplicate or triplicate using miRCURY LNA SYBR Green PCR Kits (QIAGEN). All were quantified on a QuantStudio 6 QPCR thermocycler and relative expression determined using the ΔΔCt method.

Taves M.D., Otsuka S., Taylor M.A., Donahue K.M., Meyer T.J., Cam M.C, & Ashwell J.D. (2023). Tumors produce glucocorticoids by metabolite recycling, not synthesis, and activate Tregs to promote growth. The Journal of Clinical Investigation, 133(18), e164599.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis from Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organs collected from freshly killed mice (8-10 weeks of age) were snap frozen in liquid nitrogen immediately after dissection and stored at −80°C until further processing. Organs were homogenized with glass beads (425-600 μm, Sigma-Aldrich) in TRIzol (Thermo Fisher Scientific) using a FastPrep F120 instrument (Thermo Savant). RNA was extracted following the manufacturer’s instructions and further purified using RNeasy Plus columns (QIAGEN) including a gDNA eliminator column step. cDNA synthesis was performed with SuperScript II reverse transcriptase (Thermo Fisher Scientific) with random hexamer (QIAGEN) or oligo (dT)_12-18 (Thermo Fisher Scientific) as primers. Gene-specific reverse transcription was primed with Taqman probes (Applied Biosystems). qPCR was done using Taqman Universal PCR Mix (Thermo Fisher Scientific) and Taqman probes. Alternatively, qPCR was performed using EXPRSS SYBR GreenER qPCR Supermix (Thermo Fisher Scientific) and DNA oligonucleotides (Sigma Aldrich). qPCR was performed on a QuantStudio 7 Flex real-time PCR system (Applied Biosystem). The qPCR probes and primers used in this study are listed in Table S2.

Tang Q., Rigby R.E., Young G.R., Hvidt A.K., Davis T., Tan T.K., Bridgeman A., Townsend A.R., Kassiotis G, & Rehwinkel J. (2021). Adenosine-to-inosine editing of endogenous Z-form RNA by the deaminase ADAR1 prevents spontaneous MAVS-dependent type I interferon responses. Immunity, 54(9), 1961-1975.e5.

+ Open protocol

+ Expand

RNA Isolation and qPCR from Mouse Organs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organs collected from freshly killed mice (8-10 weeks of age) were snap frozen in liquid nitrogen immediately after dissection and stored at -80°C until further processing. Organs were homogenised with glass beads (425-600 µm, Sigma-Aldrich) in TRIzol (Thermo Fisher Scientific) using a FastPrep F120 instrument (Thermo Savant). RNA was extracted following the manufacturer's instructions and further purified using RNeasy Plus columns (Qiagen) including a gDNA eliminator column step. cDNA synthesis was performed with SuperScript II reverse transcriptase (Thermo Fisher Scientific) with random hexamer (Qiagen) or oligo (dT)12-18 (Thermo Fisher Scientific) as primers. qPCR was done using Taqman Universal PCR Mix (Thermo Fisher Scientific) and Taqman probes (Applied Biosystems). Alternatively, qPCR was performed using EXPRSS SYBR GreenER qPCR Supermix (Thermo Fisher Scientific) and DNA oligonucleotides (Sigma Aldrich). qPCR was performed on a QuantStudio 7 Flex real-time PCR system (Applied Biosystem). The qPCR probes and primers used in this study are listed in Table S2.

Tang Q., Rigby R.E., Young G.R., Korning-Hvidt A., Tan T.K., Bridgeman A., Townsend A., Kassiotis G., & Rehwinkel J. (2020). Recognition of Z-RNA by ADAR1 limits interferon responses.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!