Log In Sign up
The largest database of trusted experimental protocols

T7 rnamax kit

Manufactured by Thermo Fisher Scientific
Visit Supplier

The T7 RNAmax kit is a set of reagents designed for the in vitro transcription of RNA. The kit includes a T7 RNA polymerase, nucleotides, buffer, and other components necessary for the production of RNA from a DNA template.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

T7 kits (3 citations) RNAmax (2 citations)

2 protocols using t7 rnamax kit

1

CRISPR-Cas9 Editing of Zebrafish trip11

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gRNA site GGTCAGAGTTTGGGTCAGGTCGG in exon 1
of the zebrafish trip11 gene was targeted. This site is 33 bp
downstream of the ATG start codon of trip11. gRNA sequences
were cloned in the BsaI site of the DR274 plasmid and in vitrotranscribed with T7 RNAmax kit (ThermoFisher) Cas9 mRNA was obtained from
SystemBio (CAS500A-1). Injections of fertilized zebrafish eggs were done with 50
ng/ul gRNA and 150 ng/ul Cas9 mRNA. Genotyping was performed using
5’-CCCTGGTCGGTGATTTAGGGTTAG-3’ as forward primer and 5’
CACCTCCCACTTCCTCGGCGCTTTCCAGCAGAATATCTTTGGTAAAATTAGAG-3’ as reverse
primer. PCRs using this primer pair yield a 178 bp wildtype band. Fish were
identified with a 47 bp deletion spanning the gRNA target site and yielding a
131 bp genotyping band. The deleted sequence is 5’
-CTGGGTCAGAGTTTGGGTCAGGTCGGGGGAAGCTTGTCTTCATTTAC-3’ and generates a
frameshift at the 12th amino acid residue of trip11.
Daane J.M., Dornburg A., Smits P., MacGuigan D.J., Hawkins M.B., Near T.J., Detrich HW I.I.I, & Harris M.P. (2019). Historical contingency shapes adaptive radiation in Antarctic fishes. Nature ecology & evolution, 3(7), 1102-1109.
+ Open protocol
+ Expand
2

CRISPR-Cas9 Editing of Zebrafish trip11

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gRNA site GGTCAGAGTTTGGGTCAGGTCGG in exon 1
of the zebrafish trip11 gene was targeted. This site is 33 bp
downstream of the ATG start codon of trip11. gRNA sequences
were cloned in the BsaI site of the DR274 plasmid and in vitrotranscribed with T7 RNAmax kit (ThermoFisher) Cas9 mRNA was obtained from
SystemBio (CAS500A-1). Injections of fertilized zebrafish eggs were done with 50
ng/ul gRNA and 150 ng/ul Cas9 mRNA. Genotyping was performed using
5’-CCCTGGTCGGTGATTTAGGGTTAG-3’ as forward primer and 5’
CACCTCCCACTTCCTCGGCGCTTTCCAGCAGAATATCTTTGGTAAAATTAGAG-3’ as reverse
primer. PCRs using this primer pair yield a 178 bp wildtype band. Fish were
identified with a 47 bp deletion spanning the gRNA target site and yielding a
131 bp genotyping band. The deleted sequence is 5’
-CTGGGTCAGAGTTTGGGTCAGGTCGGGGGAAGCTTGTCTTCATTTAC-3’ and generates a
frameshift at the 12th amino acid residue of trip11.
Daane J.M., Dornburg A., Smits P., MacGuigan D.J., Hawkins M.B., Near T.J., Detrich HW I.I.I, & Harris M.P. (2019). Historical contingency shapes adaptive radiation in Antarctic fishes. Nature ecology & evolution, 3(7), 1102-1109.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!