Stealth select sirna

Knockdowns in HepG2 cells using small interfering RNA (siRNA) were performed as previously described (Rutkevich et al., 2010 (link), 2012 (link)). Knockdowns in N2a cells were performed with 50 nM of Stealth Select siRNA (Life Technologies) and 7.5 μl of Lipofectamine RNAiMAX (Life Technologies) in 3 ml of DMEM without serum or antibiotics. After 4 h, the medium was adjusted to 10% serum in a total of 5 ml. Both cell lines were transfected on day 1 and again on day 4, followed by analysis on day 7. Controls were performed with nontargeting negative control Stealth Select siRNA.
Knockdowns using shRNA were performed with pLKO.1 plasmids obtained from the RNAi Consortium (www.broadinstitute.org/rnai/trc), using their protocol for lentiviral production. In brief, 293T cells growing in T25 filter cap flasks were used as packaging cells and transfected using FuGENE 6 with 100 ng of envelope plasmid VSV-G/pMD2.G, 900 ng of packaging plasmid pCMV-dR8.74psPAX2, and 1 μg of targeting pLKO.1 plasmid. The cells were cultured for ∼18 h after transfection, followed by a medium replacement containing 30% FBS. Virus was collected after 48 h and added to U373-MG cells in growth medium with 8 μg/ml Polybrene. Puromycin selection (1 μg/ml) was initiated 48 h postinfection for 3 d.

Twenty-four hours before transfection, the cells were counted and plated. Twenty picomoles of Invitrogen's Stealth Select siRNA (a pool of three different sequences targeting the same gene) or universal control siRNA with matching percentage GC content and Lipofectamine RNAiMax reagent (Invitrogen) was used according to the manufacturer's instructions. The siRNA sequences along the HDAC1 mRNA sequence (5′–3′) were: aacgaauugccugugaggaa gaguu (siRNA 1A), gcaugacucauaauuugcugcucaa (siRNA 1B), and caguauucgauggccuguuugaguuc (siRNA 1C). The siRNA sequences along the HDAC2 mRNA sequence (5′–3′) were: ucu aacagucaaaggucaugcuaaa (siRNA 2A), gaagauccagacaagagaa uuucua (siRNA 2B), and ggugauggagauguaucaaccuagu (siRNA 2C).