Log In Sign up
The largest database of trusted experimental protocols

Nucleospin rna set for nucleozol kit

Manufactured by Macherey-Nagel
Visit Supplier
Sourced in Germany

The NucleoSpin RNA set for NucleoZOL kit is a laboratory equipment product designed for RNA extraction. It provides the necessary components to isolate total RNA from various sample types using the NucleoZOL reagent.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (2 mentions) Transcriptor universal cdna master, by Roche (1 mentions) High capacity cdna kit, by Thermo Fisher Scientific (1 mentions) Gotaq qpcr master mix, by Promega (1 mentions)

Spelling variants of this product

NucleoSpin RNA kit (1492 citations) NucleoSpin RNA (308 citations) NucleoZOL (164 citations) NucleoSpin kit (156 citations) NucleoSpin RNA Set for NucleoZOL (16 citations) NucleoZOL kit (10 citations)

2 protocols using nucleospin rna set for nucleozol kit

1

Quantifying Lipase Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the NucleoSpin RNA set for NucleoZOL kit (Macherey-Nagel, Düren, Germany). cDNA was synthesized from 500 ng total RNA with Transcriptor Universal cDNA master (Roche Diagnosis, IN). For real-time PCR, the following primers were used: hormone-sensitive lipase (LIPE, forward ACGGTGGCCGATGCCATGTT and reverse AGCTGCGTGGGGCTGAGTTT) and adipose triglyceride lipase (ATGL, forward GTGTCAGACGGCGAGAATG and reverse TGGAGGGAGGGAGGGATG). Relative quantification was performed by real-time PCR as described [44 (link)].
Gastaldi G., Gomes D., Schneiter P., Montet X., Tappy L., Clément S, & Negro F. (2019). Treatment with direct-acting antivirals improves peripheral insulin sensitivity in non-diabetic, lean chronic hepatitis C patients. PLoS ONE, 14(6), e0217751.
+ Open protocol
+ Expand
2

Quantifying Gene Expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
We homogenized tissues and cells in TRIzol (Thermo Fisher) and isolated total RNA using the NucleoSpin RNA set for Nucleozol kit (Macherey–Nagel) and prepared cDNA using 1 μg of total RNA with the High-Capacity cDNA Kit (Applied Biosystems). We then measured gene expression by Real-time PCR (qPCR) using GoTaq qPCR master mix (Promega). We calculated relative gene expression using the ΔΔCt methods with ribosomal protein L23 (Rpl23) and cyclophilin A (CypA) as the reference genes in the tissues and cells respectively.
Namwanje M., Liu L., Chan M., Aaron N., Kraakman M.J, & Qiang L. (2019). The depot-specific and essential roles of CBP/p300 in regulating adipose plasticity. The Journal of endocrinology, 240(2), 257-269.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!