Megascript rnai kit

For RNAi, double-stranded RNAs (dsRNAs) encoding TXA₂ synthase (dsTXAS), SePGE₂R (dsPGE₂R), and green fluorescence protein (dsCON) were prepared as described by Vatanparast et al. (38 (link)) using Megascript RNAi Kit (Ambion, Austin, TX, USA). dsRNAs were mixed with a transfection reagent Metafectene PRO (Biontex, Plannegg, Germany) at a 1:1 (v/v) ratio and incubated at room temperature for 30 min to form liposomes. dsRNA (1 µg) was injected into L5 larval hemocoel with a microsyringe. The RNAi efficiency was evaluated by RT-qPCR at the selected time points. Each treatment was replicated three times using independent RNA preparations.

Template DNA flanked by the T7 promoter sequence was synthesized to produce the dsRNA of CBW nucleases (AgraNuc1, AgraNuc2 and AgraNuc3) and chitin synthase II, as well as gus dsRNA [26 ]. PCR reactions for the amplification of adult CBW cDNA were performed with specific primers (10 mM) for each gene (Table 1), an annealing temperature of 55°C, 10X buffer, 50 mM MgCl₂, 10 mM dNTP and 1 U Taq polymerase (Invitrogen) following the manufacturer’s recommended protocol. The amplified products were analyzed by agarose gel electrophoresis (1%), and the amplified fragments were purified with a QIAquick PCR purification kit (Qiagen) and ligated into the PCR2.1 vector following the manufacturer’s recommended protocol (ThermoFisher). The ligation product was transformed into Escherichia coli XL1-Blue. The recombinant plasmid DNA was extracted from positive white colonies, and a PCR reaction was performed as described above with primers T7 and T7M13 Rv (Table 1). The amplified products were purified with a QIAquick PCR purification (Qiagen) kit, and the purified products were used as a template for dsRNA synthesis using the MEGAscript RNAi kit (Ambion), following the manufacturer’s recommended protocol. The dsRNAs length for AgraNuc1, AgraNuc2 and AgraNuc3 was, respectively, 291, 290 and 305 pb.

The dsRNA fragments were prepared by in vitro transcription using MEGAscript^® RNAi Kit (Ambion) according to manufacturer’s instructions. Three dsRNA fragments: 5′-dsRNA, Mid-dsRNA and 3′-dsRNA were prepared to target the 5′, middle and 3′ regions of the PhoCHSA transcript, respectively. The numbers supplied with each primer pair (Table 1) represent the region to be targeted by the dsRNA, where in all cases a region around 500 bp was selected. Ampicillin resistance gene specific dsRNA (dsAmpR) was prepared using AMPF and AMPR primer set (Table 1) to be used as a control. Each primer contains the T7 promoter sequence (TAATACGACTCACTATAGGG) at the 5′ end that is necessary for RNA synthesis. The dsRNA produced was eluted in ddH₂O, quantified by spectrophotometer and stored at −20 °C till injection.

The 373 bp fragment of BmCPG10 cDNA was amplified using the wild-type silkworm cDNA as a template for RNA synthesis with the following primers containing the promoter of T7: forward: 5-TAATACGACTCACTATAGGGAAGGGACATCTTGAACC-3, reverse: 5-TAATACGACTCACTATAGGCGCAAAGTCACAGGAAAC-3. The dsRNA was synthesized using a MEGA script RNAi kit (Ambion). RNA synthesis and purification were performed according to the manufacturer’s instructions, and the integrity of dsRNA was confirmed by nondenaturing agarose gel electrophoresis. The quality of the dsRNA was determined at a 260/280 absorbance ratio, and the dsRNA was diluted to a final concentration of 2000 ng/μL with an injection buffer. EGFP dsRNA was synthesized using the method of Quan et al [18 (link)].

Templates with T7 promoters appended to both strands were generated. Double‐stranded RNA (dsRNA) was synthesized by using the in vitro transcription MEGAscript RNAi kit (Ambion). dsRNA was injected ventrally into the planarian following the conventional schedule of three consecutive days of injections followed by another round of injections for three consecutive days twelve days later of the first round of injections as previously described (González‐Estévez et al, 2012). As a control, dsRNA against gfp was used as a sequence not contained in the planarian genome. Planarians of 5 to 5.5 mm length at 7 days of starvation were used for the experiments. Details on the RNAi schedules are in the “Results” section.

To generate dsRNA for each gene, two pairs of primers (without and with T7 promoter extension: TAATACGACTCACTATAGGGAGA) were used to generate PCR product template (S2 Table). Equal amounts of sense and antisense template strands were mixed before dsRNA synthesis. dsRNA synthesis was performed with T7 RNA Polymerase from MEGAscript^® RNAiKit (Ambion Inc.) according to manufacturer instructions. Final concentration of dsRNA was measured with spectrometry (NanoDrop Technologies Inc.) and adjusted to 1.5 μg/μl.

LlTGF-β cDNA template was amplified by PCR using primers containing the T7 promoter at the 5' end (dsTGFb-F and dsTGFb-R—Table 1). The control dsRNA cDNA template was obtained from β-galactosidase gene amplified from plasmid pGEM T-easy vector (PROMEGA) (Tinoco-Nunes et al., 2016 (link)). The PCR products were used as templates for transcription reactions with the Megascript RNAi Kit (Ambion) according to the manufacturer's instructions and subsequently concentrated to 40 μg/μL using a vacuum microcentrifuge concentrator.