Qiaprep miniprep kit

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Portugal

The QIAprep Miniprep kit is a laboratory tool used for the rapid and efficient purification of plasmid DNA from bacterial cultures. It is designed to provide high-quality plasmid DNA suitable for various downstream applications, such as sequencing, restriction analysis, and transfection.

Automatically generated - may contain errors

Lab products found in correlation

Qiaquick gel extraction kit, by Qiagen (13 mentions) Qiaquick pcr purification kit, by Qiagen (10 mentions) Pgem t easy vector, by Promega (4 mentions) Pgem t easy vector system, by Promega (4 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions) Gel extraction kit, by Qiagen (3 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (3 mentions) Qiaquick kit, by Qiagen (3 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Dneasy tissue kit, by Qiagen (2 mentions) Bamhi hf, by New England Biolabs (2 mentions) Taq dna polymerase, by New England Biolabs (2 mentions) Phusion polymerase, by New England Biolabs (2 mentions) Jm109 chemically competent e coli, by Takara Bio (2 mentions) Qiaex 2 gel extraction kit, by Qiagen (2 mentions) T4 ligase, by New England Biolabs (2 mentions) Q5 polymerase, by New England Biolabs (2 mentions) Gibson assembly master mix, by New England Biolabs (2 mentions) Phusion hs 2 dna polymerase, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

QIAprep Spin Miniprep or Midiprep Kits QIAprep 96 Turbo Miniprep Kit QIAprep Spin Plasmid Miniprep Kit QIAprep plasmid Miniprep kit QIAprep Spin Miniprep Kit QIAprep Turbo Miniprep Kit QIAprep Spin Miniprep Kit 250 QIAprep Miniprep QIAprep kit QIAprep

118 protocols using qiaprep miniprep kit

Bacterial Genomic DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thermoanaerobacter tengcongensis was supplied lyophilised by The Leibniz Institute DSMZ (DSM number 15242 Caldanaerobacter subterraneus subsp. tengcongesis), and was re-suspended in 1 mL of 20% (w/v) glycerol. Chromobacterium violaceum and Deinococcus geothermalis were supplied by J. Ward as glycerol stocks. Chromosomal DNA was prepared by diluting the glycerol stocks 1 in 10 with sterile water. Lysozyme was added to this dilution to give a final concentration of 50 µg/mL and the mixture was incubated at 37 °C for 15 min. SDS was then added to give a final concentration of 1% (v/v), turning the mixture clear and viscous. 250 µL of this solution was combined with a vortexed mixture of P2 (250 µL) and N3 (350 µL) reagents (QIAprep Miniprep Kit, Qiagen) and centrifuged for 10 min at 17,000×g. The supernatant was loaded onto a spin column (QIAprep Miniprep Kit, Qiagen) with the standard miniprep protocol followed from this point onwards. The genomic DNA was eluted with 100 µL EB buffer, and used directly for PCR. Genomic DNA from D. geothermalis was provided by Dr Maria Bawn.

Sibley M, & Ward J.M. (2021). A cell engineering approach to enzyme-based fed-batch fermentation. Microbial Cell Factories, 20, 146.

+ Open protocol

+ Expand

Construction and Validation of DR5-Luc Reporter Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pGL3-DR5 plasmid was a gift from Dr. Hong-Gang Wang (Penn State, Hershey, PA; ref. 16 (link)). This plasmid contained a DR5 5’ flanking sequence (−552 to −7) with a CHOP binding region and mutant NF-kB region (Supplementary Fig. S1). The DR5 5’ flanking sequence was subcloned into the pGL4.21 plasmid (Promega) upstream of the luciferase reporter using a Rapid DNA Ligation Kit (Roche). DH5α containing the DR5-Luc plasmid were expanded under ampicillin selection followed by DNA extraction using QIAprep Miniprep Kit (Qiagen). Insertion of the DR5 sequence was confirmed using an E-Gel following restriction digestion with Sac1 and Xho1. Selected clones were expanded in LB Broth under ampicillin selection followed by DNA extraction using a Qiagen Maxi Prep Kit. U251 cells were transfected with the DR5-Luc plasmid using Lipofectamine 2000 (Invitrogen), and grown under puromycin (2 μg/mL) selection. Single clones were selected and expanded using DMEM supplemented with Puromycin (1 μg/mL). U251 DR5-Luc clones were probed for luciferase expression following Nelfinavir treatment, leading to identification of a single positive clone. Dose-dependent expression of DR5 and Luciferase in this clone was confirmed via Western Blot analysis and bio-luminescent imaging (IVIS Spectrum; PerkinElmer).

Sheikh S., Saxena D., Tian X., Amirshaghaghi A., Tsourkas A., Brem S, & Dorsey J.F. (2019). An Integrated Stress Response Agent that Modulates DR5-Dependent TRAIL Synergy Reduces Patient-Derived Glioma Stem Cell Viability. Molecular cancer research : MCR, 17(5), 1102-1114.

+ Open protocol

+ Expand

Constructing Mycobacterium Prophage Gene Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The promotorless mycobacterium shuttle vector pFJS3 (Table 1) was used for making the prophage gene constructs; it was propagated and purified from E. coli using the QIAprep Miniprep kit (QIAGEN, Valencia CA). M. avium strain 104 was used as a source of genomic DNA for prophage gene amplification by PCR. Three unique PCR primer sets with HindIII restriction site were designed to amplify the prophage genes with additional 150 bp sequence upstream of the start codon to include its native ribosomal binding site and promoter (Table 2). PCR amplification was performed in a 30 μl volume vial containing 13.5 μl of sterile H₂O, 1 μl DMAO, 15 μl Fidelitaq mix (2X), 0.25 μl prophage-specific forward and reverse primers (100 μM). The PCR parameters were set as follows: 95°C for 5 min for the initial denaturing step, followed by 35 cycles of 95°C for 30 s, annealing at 55°C for 30 s and 72°C for 2 min, with a final extension at 72°C for an additional 5 min, and then placed at 4°C. Because MAC_3971 was not shown to have a role in any of the phenotype evaluated, we decided to use a couple variants of the promoter sequence, extended by 25 and 50 bp.

Zhao M., Gilbert K., Danelishvili L., Jeffrey B, & Bermudez L.E. (2016). Identification of Prophages within the Mycobacterium avium 104 Genome and the Link of Their Function Regarding to Environment Survival. Advances in microbiology, 6(13), 927-941.

+ Open protocol

+ Expand

Lentiviral shRNA-Mediated Gene Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids encoding lentiviruses expressing shRNA molecules were obtained from The RNAi Consortium shRNA Library. The shRNA target 21-mer sequences were: shControl, CCTAAGGTTAAGTCGCCCTCG; mouse shTREML4 #1, GCAGTGCCAATACAAGCCTAA; mouse shTREML4 #2, AGAAGTAACTGTTCTCAGAAA; mouse shMyD88, GCCAGCGAGCTAATTGAGAAA; human shTREML4 #1, TGACACAGAATGACTCGGGAT; human shTREML4 #2, ACGTCTCCTATGTGGACTCTT; human shTREML4 #3, GTGCCTGAAGAACTTCACAAA; human shTREML4 #4, GAATCTACAACGCTTCCGAAA; human shTREML4 #5, CCTCCATCAATGGCTCTGAGA. Plasmids were purified with a QIAprep Miniprep kit (Qiagen). Plasmids were then transfected into HEK293T cells along with pCMV-dR8.2 dvpr and pCMV-VSVG for the production of lentivirus. RAW-GFP or THP-1 cells were placed in 24-well tissue culture dishes (2 × 10⁵ cells per well) and were infected with 100 μl unconcentrated shRNA lentiviral supernatant and polybrene (7.5 μg/ml). Cells were spun for 30 min at 800g, media replaced, and incubated for 2 days. Infected cells were selected in complete RPMI medium containing 10% (vol/vol) FBS and puromycin (3 μg/ml) and were tested 1 week after infection. The shRNA knockdown efficiency was determined by qPCR.

Ramirez-Ortiz Z.G., Prasad A., Griffith J.W., Pendergraft WF I.I.I., Cowley G.S., Root D.E., Tai M., Luster A.D., Khoury J.E., Hacohen N, & Means T.K. (2015). TREML4 amplifies TLR7-mediated signaling during antiviral responses and autoimmunity. Nature immunology, 16(5), 495-504.

+ Open protocol

+ Expand

Nucleic Acid Extraction from Rhodococcus and E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

To extract genomic DNA from Rhodococcus, the Wizard Genomic DNA Purification Kit was used, following the instructions of the manufacturer for Gram-positive bacteria (Promega Corporation, Madison, WI, United States). To extract plasmids from E. coli, the Qiagen QIAprep Miniprep Kit was used, following the instructions of the manufacturer (Qiagen Company, Hilden, Germany). To extract RNA from Rhodococcus, cells were pelleted and resuspended in 500 μl Tri-Reagent (Sigma-Aldrich) in 2 ml tubes containing Lysing Matrix B (MP Biomedicals, Irvine, CA, United States). A FastPrep24 (MP Biomedicals, Irvine, CA, United States) was used to lyse cells for 1 min at 6.0 M/s. After, 100 μl of chloroform was added to each tube. Tubes were vortexed briefly and centrifuged for 10 min at 4°C at maximum speed. The upper phase was transferred to a new tube and 350 μl of isopropanol was added. Samples were incubated at −20°C overnight and then centrifuged for 10 min at 4°C at maximum speed. The supernatant was decanted, samples were washed two times with 70% ethanol, and the RNA was resuspended in DEPC-treated H₂O.

Savory E.A., Weisberg A.J., Stevens D.M., Creason A.L., Fuller S.L., Pearce E.M, & Chang J.H. (2020). Phytopathogenic Rhodococcus Have Diverse Plasmids With Few Conserved Virulence Functions. Frontiers in Microbiology, 11, 1022.

+ Open protocol

+ Expand

Rescue and Characterization of Recombinant Coronavirus

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmid pSEA was purified from the E. coli DH10B strain using QIAprep Miniprep Kit (Qiagen) and quantified by a NanoDrop spectrophotometry. BHK-21 cells were seeded at 2×10⁵ per well of a six-well plate and grown until 60–70% confluence before transfection. One microgram each of pSEA and pRK-N-FLAG were co-transfected into the cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer's protocol. Transfected cells were cultured for 2–3 days. The supernatant was collected and passaged onto fresh Vero cells on 12-well plates and cultured for 3 days before the detection of viral protein expression by IFA. The recombinant SeACoV rescued from the pSEA infectious clone was named rSeACoV. The rSeACoV titers were determined by endpoint dilutions as TCID₅₀. Viral particles in the supernatants from rSeACoV-infected cell cultures were negatively stained and examined under TEM. A 1.5-kb DNA fragment harboring the introduced mutations in the ORF3 gene was amplified by RT-PCR using primers TF21 (5’-TACTGGATGTTGTGGCATGT-3’) and TR21 (5’-TTCCACTTAAAATCGTCAGA-3’). The amplicons were sequenced to affirm that rSeACoV contained the desired mutations.

Yang Y.L., Liang Q.Z., Xu S.Y., Mazing E., Xu G.H., Peng L., Qin P., Wang B, & Huang Y.W. (2019). Characterization of a novel bat-HKU2-like swine enteric alphacoronavirus (SeACoV) infection in cultured cells and development of a SeACoV infectious clone. Virology, 536, 110-118.

+ Open protocol

+ Expand

Quantifying Intact Plasmid DNA from Phage Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Long-range Phusion PCR (Thermo Scientific) was combined with the TapeStation platform (Agilent Technologies) to amplify and quantify intact plasmid pBAD24 extracted from phage lysates (see Fig. S4). In contrast to the Southern blot assay and similar techniques, TapeStation offers automated sample processing and accurate digital quantification. PCR primers were designed to amplify nearly the entire pBAD24 plasmid (4,480 of 4,542 bp or 98.6%; see Table S2). Subsequently, DNA was extracted from bacterium-free phage lysates arising from lysis-and-transformation assays of MG/pBAD24 as described above, resuspended in ultrapure water, and further diluted 10-fold. Plasmid DNA was extracted from 10 µl of an overnight MG/pBAD24 culture via a commercial kit (QIAprep Miniprep kit; Qiagen), also diluted 10-fold, and used as the positive control. Following PCR completion, samples were diluted 1:10 in D5000 ScreenTape buffer and assayed via D5000 ScreenTape.

Keen E.C., Bliskovsky V.V., Malagon F., Baker J.D., Prince J.S., Klaus J.S, & Adhya S.L. (2017). Novel “Superspreader” Bacteriophages Promote Horizontal Gene Transfer by Transformation. mBio, 8(1), e02115-16.

+ Open protocol

+ Expand

Targeted Variant Identification by Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primer pairs to assess the variants were designed using NCBI Primer-BLAST and checked against the Human Reference Sequence Assembly 37.2 (NCBI build 37.2). Only primer pair sequences matching the Asian MHC haplotypes were selected. The sequences of these primer pairs and the position of variants of interest can be found in Supplementary Table S4-S5 and Table S8. PCR amplification was performed and the PCR products were sequenced.
The PCR template generated from primer sequences AGCAGTCACAAGTCACAGGG and CAGCCCATCGCATGCTCAAT was selected and subjected to TA-cloning. TA-cloning was then performed using pGEM®-T Easy Vector Systems (Promega, Fitchburg, WI), according to the manufacturer’s instructions. Colonies were selected and plasmid DNA was extracted using the QIAprep® Miniprep Kit (Qiagen), and sequenced with the T7 promoter and SP6 promoter primers.

Lam T.H., Tay M.Z., Wang B., Xiao Z, & Ren E.C. (2015). Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes. Scientific Reports, 5, 16972.

+ Open protocol

+ Expand

Phagemid Sequencing Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phagemid DNA was extracted
from XL1 blue E. coli infected with
phage eluates from the different panning rounds or the naive phage
library using a QIAprep Miniprep kit (Qiagen, Hilden, Germany). A
PCR was performed with 50 ng of purified phagemid as a template and
5 pmol of an oligo containing the forward adapter sequence and 5 pmol
of an oligo containing the reverse adapter sequence and a sample-specific
index sequence. To reduce the risk of bias and errors, the PCR was
limited to 15 cycles. The acquired PCR product was extracted from
a 2% agarose gel and purified with a QIAquick gel extraction kit.
Finally, all samples were pooled in equal amounts to reach a total
concentration of 10 nM. Sequencing was done in a flow cell of an Illumina
MiSeq v2 instrument and conducted at the National Genomics Infrastructure
(Stockholm, Sweden).

von Witting E., Lindbo S., Lundqvist M., Möller M., Wisniewski A., Kanje S., Rockberg J., Tegel H., Åstrand M., Uhlén M, & Hober S. (2020). Small Bispecific Affinity Proteins for Simultaneous Target Binding and Albumin-Associated Half-Life Extension. Molecular Pharmaceutics, 18(1), 328-337.

+ Open protocol

+ Expand

Molecular Biology DNA Preparation and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromosomal and plasmid DNA preparation, purification of DNA gel fragments and DNA clean-up was undertaken using Qiagen kits, United Kingdom (DNeasy Tissue kit, QIAprep Miniprep kit and QIAquick Gel Extraction kit). Restriction enzymes were from the New England Biolabs and used according to manufacturer’s instructions. Phusion High Fidelity and DreamTaq DNA polymerases (Thermo Fisher Scientific, United Kingdom) were used for PCR amplifications. Agarose gel electrophoresis was carried out as described (Sambrook et al., 1989 ) and oligonucleotides were synthesized by Merck, UK.

Omorotionmwan B.B., Wang H., Baker J.P., Gizynski K., Yoo M., Akaluka C., Zhang Y, & Minton N.P. (2023). Chromosomal engineering of inducible isopropanol- butanol-ethanol production in Clostridium acetobutylicum. Frontiers in Bioengineering and Biotechnology, 11, 1218099.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!