Myc ddk tag

Human CDKN1B cloned into the pCMV6-Myc-DDK tagged Entry vector containing a Myc-DDK tag (purchased from Origene, Rockville, MD) was used to generate Myc-DDK-tagged CDKN1B phosphorylation mutant plasmids, T157A and T198A. Mutagenesis reactions were done using the Quick Change Site-Directed Mutagenesis Kit (Strategene). The primers were:
T157A: forward 5′-AATAAGGAAGCGAACTGCAGCCGACGATTCTTCTA-3′
reverse 5′-TAGAAGAATCGTCGGCTGCAGGTCGCTTCCTTATT-3′
T198A: forward 5′- CTCAGAAGACGTCAAGCGACGCGTACGCG -3′
reverse 5′- CGCGTACGCGTCGCTTGACGTCTTCTGAG -3′
The introduction of each mutation was confirmed by Sanger sequencing (see Supplementary Fig. S3).

The CRISPR plasmid pCRISPR-CG01, an all-in-one sgRNA plasmid for inactivating the human cldn-1 gene, was purchased from GeneCopoeia. The cldn-1 gene target site is CACGATGTTGTCGCCGGCAT. The cldn-1 complementing plasmid RC204466, which contains cldn-1 cDNA with a C-terminal Myc-DDK tag, was purchased from Origene (Rockville, MD, USA).

The expression plasmids encoding leptin (pCMV6-Flag-Lep) or a control empty vector (pCMV6-Flag) with a C-terminal Myc-DDK tag were purchased from OriGene Technologies. Plasmids were transiently transfected into TW06 and TW02 cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. Two different synthetic interfering RNAs (siRNAs) that target leptin (leptin siRNA, Sigma-Aldrich Co., NM_000230) and has-miR-874-3p mimic / inhibitor (Sigma-Aldrich Co., HMI0926 / HSTUD0926) were transiently transfected into TW06 and TW02 cells using Lipofectamine RNAi MAX (Invitrogen, USA) according to the manufacturer’s instructions. The siRNA sequences of leptin were 5’- GGAACUCUGGCUUCCAGGU-3’ and 5’-CUGACUCCUCUAAGCCACU-3’. The sequences of miR-874-3p mimic and miR-874-3p inhibitor were 5’- CUGCCCUGGCCCGAGGGACCGA-3’ and 5’- CUGCCCUGGCCCGAGGGACCGA-3’.

HT-29 and WiDr were used and maintained, respectively, in RPMI-1640 and DMEM mediums under standardized culture conditions with 5% CO₂ in a humidified 37 °C incubator in this study. Both of the cell lines were routinely examined for mycoplasma contamination. For knockdown of COX5B, the smart pool siRNAs (Dharmacon, Lafayette, CO, USA, M-013632), siRNA 1: CGACUGGGUUGGAGAGGGA, siRNA 2: GAGCACCUGCACUAAAUUA, siRNA 3: GGGACUGGACCCAUACAAU and siRNA 4: GAGAA UAGUAGGCUGCAUC, were used. The non-targeting pool included four independent scramble siRNAs, UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA and UGGUUUACAUGUUUUCCUA, and was used as control siRNA (Dharmacon, D0018101020). The Lipofectamine RNAiMAX transfection reagent (Invitrogen, Waltham, MA, USA, 13778) was employed according to the protocol provided by the manufacturer. The plasmids capable of expressing COX5B and CLDN2 with myc-DDK tag were purchased from Origene (Rockville, MD, USA, Cat. RC202511 for COX5B and RC229728 for CLDN2). For transient expression of COX5B and/or CLDN2, the cells were seeded 16 h before transfection. Five μg of plasmid DNA was used for transfection in a 6 cm plate. The MaestroFectin (Omics Bio, New Taipei City, Taiwan, Cat. MF002) transfection reagent was used for transfection, according to the procedures provided by the manufacturer.

A vector containing the SVEP1 open reading frame followed by a Myc-DDK-tag (NM_153366, RC214271; pCMV_SVEP1) was purchased from OriGene Technologies (Rockville, MD, USA). The p.D2702G amino acid change (pCMV_SVEP1_p.D2702G) was introduced using in vitro site-directed mutagenesis (QuikChange II XL; Agilent Technologies, Santa Clara, CA, USA) according to the supplier’s protocol and using the following mutagenesis primers: SVEP1var_for: 5′-GCC ATT CCA AGT TCC ACC TTC CTG GCA GAT CAG-3′, SVEP1var_rev: 5′- CTG ATC TGC CAG GAA GGT GGA ACT TGG AAT GGC-3′. Coding sequence of human SVEP1 was then cloned into a pcDNA-pDEST40 expression vector C-terminally tagged with a HA-tag (Life Technologies, Carlsbad, CA, USA). The expression plasmids were sequenced on both strands prior to transfection of eukaryotic cells.

The cDNA clone of mouse SM phosphodiesterase 3 (Smpd3; NM_021491) in mammalian expression vector (pCMV6-Entry) with C-terminal Myc- DDK Tag was purchased from OriGene Technologies (Catalog # MR209795). The mouse nSMase-2 gene has 22 cysteine residues, with five of these (Cys⁵³, Cys⁵⁴, Cys⁵⁹, Cys³⁹⁵, and Cys³⁹⁶) having previously been shown to undergo palmitoylation (30 (link)). These five cysteines were mutated to alanines to produce a complex mutant, named C-A(5)-nSMase2, sequentially using synthetic oligonucleotides and the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Catalog # 210513). The sequence of the oligonucleotides used for mutagenesis (Integrated DNA Technologies were as follows: For the C53A, C54A mutant: 5′-gcagaacagctgcagggcggcggggtcatctgccctc-3′ and 5′-gagggcagatgaccccgccgc cctgcagctgttctgc-3’. For C59A: 5′-gtgaagaggaccgtggcgaacagctgcaggca-3′ and 5′-tgcctgcagctgttcgccacggtcc tcttcac-3'. For C395A, C396A: 5′-gctgttgagacatttgaaattggcggcaccatgacaaccgtagacccca-3′ and 5′-tggggtcta cggttgtcatggtgccgccaatttcaaatgtctcaacagc-3'.