Anaerobic workstation

C. difficile ribotypes 012 (strain 630), 017, 020, 023, 027 (strain R20291), 029, 046, 056, 095, 106, 117, and 126 were cultured in brain heart infusion (BHI) broth medium supplemented with 0.5% yeast extract (BHIY). Anaerobic condition was provided by anaerobic workstation (Don Whitley Scientific) maintaining at 37 °C. Minimal inhibitory concentration (MIC) assay was performed by microdilution method as per CLSI M11-A6³² . Briefly, assay plates were pre-filled with 100 µL of various concentrations of test compounds; 0.03–16 µg/mL for metronidazole and vancomycin, 0.15–80 µg/mL for ticagrelor. Ten microliters of 10⁷ CFU/mL bacterial inoculum was then added and incubated for 48 h in anaerobic workstation at 37 °C. Vancomycin solution was prepared in deionized water. Metronidazole and ticagrelor were prepared in DMSO. The assay plates were measured for OD₆₀₀ by a microtiter plate reader (Tecan) to determine the bacterial growth. The MIC value is defined by the lowest concentration of test compound that shows no bacterial growth comparable to blank BHIY medium.

Approximately 1 g of material was collected from both ceca and combined in pre-weighed universals before a 10% w/v suspension was prepared in MRD (Oxoid). Campylobacter were enumerated in triplicate from decimal dilutions prepared in MRD to 1 × 10⁻⁷ using a modification of the Miles and Misera technique. For each triplicate dilution set, five aliquots were dispensed onto CCDA agar (PO0119; Oxoid) prepared with the addition of agar to 2% (to prevent swarming) and with addition of CCDA Selective Supplement SR0155 (Oxoid). Plates were incubated at 42 °C in a microaerobic atmosphere (2% H₂, 5% CO₂, 5% O₂, 88% N₂) for 48 h (Don Whitley Scientific modified atmospheric cabinet, Shipley, UK). Coliforms were enumerated by application of aliquots of 100 μl from decimal dilutions of the cecal suspension to MacConkey No 3 agar (CM115; Oxoid) and incubation at 37 °C for 24 h. Lactic acid bacteria were enumerated by application of aliquots of 100 μl from decimal dilutions of the cecal suspension to MRS agar (CM0361; Oxoid) and incubation under anaerobic conditions at 30 °C for 48 h (Don Whitley Scientific anaerobic workstation). Between 30 and 300 colonies were counted on MacConkey No 3 and MRS agars, and the count per gram of cecal material was calculated by multiplying by the dilution factor.

Escherichia coli strains “NEB^® 5-alpha competent E. coli” and “T7 Express competent E. coli” were used for cloning purposes recombinant protein expression, respectively. Both strains were purchased from New England Biolabs (NEB), Hitchin, UK. The strains were cultured aerobically in Luria Bertani (LB) broth with shaking or on LB agar (Fisher Bioreagents, Loughborough, UK) at 37 °C, unless stated otherwise. Where appropriate, ampicillin was added to a final concentration of 100 µg/mL.
Clostridioides difficile strain 630 was kindly provided by Peter Mullany, UCL. Strain 630 is a virulent, multi-drug resistant strain isolated in 1985 from a hospital patient with severe pseudomembranous colitis which spread to other patients on the same ward in Zurich, Switzerland [47 (link)]. This outbreak strain harbours the two toxins TcdA and TcdB and belongs to the PCR ribotype 012, and has now been adopted as the reference strain for laboratory studies [48 (link)].
C. difficile strain 630 was cultured in Brain Heart Infusion medium (Oxoid) supplemented with 5 μg/mL yeast extract and 0.1% (w/v) L-cysteine (BHIS) containing selective supplements, 250 μg/mL D-cycloserine and 8 μg/mL cefoxitin (Oxoid) (BHIS CC). The strain was incubated overnight at 37 °C in an anaerobic workstation (Don Whitley Scientific, Bingley, UK) with an atmosphere of CO₂ (10%), H₂ (10%) and N₂ (80%).

All LAB strains were grown in de Man Rogosa Sharpe (MRS) broth at 37°C for 48 h in an anaerobic workstation (Don Whitley Scientific, W Yorkshire, UK). The LAB cells were then pelleted by centrifugation at 10,000 × g, 4°C for 10 min, and the supernatants were collected using 0.22 μm microfilters. The pH of the cell-free serum (CFS) and uninoculated MRS broth controls was adjusted to 7.35–7.45 using sodium hydroxide (Sigma-Aldrich, St. Louis, MO, USA) and samples were stored at −80°C until further use.
The cytotoxicity of the pH-adjusted CFS samples was assessed using Cell Counting Kit-8 (CCK-8; Glpbio, Montclair, CA, USA). Five-fold dilutions of the CFS were prepared and cytotoxicity was re-evaluated if RAW264.7 cell viability failed to remain at 100% after 24 h of incubation with the CFS. CFS with the lowest toxicity was defined as minimum non-toxic dilutions (MNTDs).

For Citrobacter rodentium infection, C. rodentium DBS100 (ATCC51459) was grown in Luria-Bertani broth at 37°C for 15–16 h. After centrifugation and washing with PBS three times, the bacteria were suspended in PBS at a proper concentration. Mice were infected once with 1 × 10⁹ CFU/mouse by oral gavage.
For commensal bacteria culture, the cecal contents of HVEM^+/- or BTLA^+/- mice were resuspended in 100 times volume of sterile PBS followed by a static settlement for 10 min at room temperature. Then, 100 μl of the supernatant was inoculated anaerobically on a MRS agar plate overnight at 37°C. All the colonies formed were transferred to MRS medium and cultured for another 6-8 h in an anaerobic workstation (Don Whitley Scientific, Bingley, UK) before used for ELISA test.

Fresh fecal samples from DSS group were collected and mixed in anaerobic sterile Ringer working buffer in an anaerobic workstation (Don Whitley Scientific Ltd, Shipley, UK). The 10⁵ diluted suspension with Ringer working buffer was placed onto 46 medium plates (Table S1) and incubated under anaerobic condition (80% N₂, 10% CO₂, and 10% H₂) at 37°C for 7 days. The 16S rRNA gene of each colony was obtained using the primers 27-F (AGAGTTTGATCCTGGCTCAG) and 1492-R (GGTTACCTTGTTACGACTT). The obtained 16S rRNA sequences were sequenced and aligned with the ASVs in Muribaculaceae enriched in the gut of DSS-treated mice. One Muribaculaceae strain (MF13079) was isolated using a previously reported MPYG medium [41 (link)] which was modified by adding 3% fetal bovine serum (FBS, GIBCO, 10099-141). The Muribaculaceae strain MF13079 16S rRNA sequence was aligned with the GenBank. All the 16S rRNA sequence of the isolated strains in the family Muribaculaceae and the 16S rRNA sequence of the representative strains in other families of the phylum Bacteroidota were selected to build a phylogenetic tree by using the Neighbor-Joining method in MEGA 6.

Escherichia coli strains were purchased from New England Biolabs (NEB), Hitchin, UK; “NEB^® 5-alpha competent E. coli” was used for cloning purposes and “T7 Express competent E. coli” was used for recombinant protein expression. Strains were cultured aerobically in Luria Bertani (LB) broth with shaking or on LB agar (Fisher Bioreagents, Loughborough, UK) at 37 °C unless stated otherwise. Where appropriate, ampicillin was added to a final concentration of 100 µg/mL.
Clostridioides difficile strain 630 (PCR ribotype 012) was kindly provided by Peter Mullany, UCL. Strain R20291ermB was previously generated in which ermB conferring resistance to erythromycin was integrated into the genome of epidemic strain R20291 (PCR ribotype 027) [46 (link)]). Strains were cultured in Brain Heart Infusion medium (Oxoid) supplemented with 5 μg/mL yeast extract and 0.1% w/v L-cysteine (BHIS) containing selective supplements; 250 μg/mL D-cycloserine and 8 μg/mL cefoxitin (Oxoid) (BHIS CC). Strains were incubated overnight at 37 °C in an anaerobic workstation (Don Whitley Scientific, Bingley, UK) with an atmosphere of CO₂ (10%), H₂ (10%) and N₂ (80%).