Stop solution

3-(4,5-Dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assays were conducted to assess the effects of polyamines and polyamine inhibitors on the viability of MSCs. Here, MSCs were plated into 96-well plates at 5000 cells/well in quadruplicate. The next day, cells were treated with the proper conditions and incubated for 48 h. Then, cells were washed once with PBS and incubated for 2 h at 37 °C in MSC culture media containing 5% MTT solution (5 mg/mL). Then, stop solution (Promega, cat# G4101) was added and plates were placed at 4 °C overnight. Plates were read by a spectrophotometer at 570 nm with a reference reading at 650 nm.

Isolated RNA was performed with DNAse for 30 min at 37°C, followed by 10 min at 65°C in stop solution (Promega, Madison, USA). Correct DNA-digestion was checked by control-gel. First-strand cDNA was generated from normalized RNA amounts using Oligo-(dT)-primers and the RevertAid Premium First Strand cDNA Synthesis Kit (Fermentas, Rockford, USA) following instructions of the manufacturer. RT-PCR was performed with taq-polymerase (Red PCR master mix, stratec, Berlin, Germany) and specific primer pairs: GAPDH (1,177 bp fragment; forward: GACCCCTTCATTGACCTC, reverse: GCAATGCCAGCCCCAG; Program: 95°C for 2 min, (95°C for 30 s, 58°C for 45 s, 72°C for 45 s) × 32, 72°C for 2 min), human Glo-I (921 bp fragment; forward: CTTCTGGGGTTTCAATTCCTC, reverse: AATCCATTTCACCCAAAAAGG), mouse Glo-I (940 bp fragment; forward: GATTTGGTCACATTGGGATTG, reverse: AGAGAGCATAGGCCAGACTCC). For Glo-I primer pairs, we used the following PCR program: 95°C for 2 min, (95°C for 30 s, 56°C for 45 s, 72°C for 45 s) × 30, 72°C for 2 min for human primer pairs and 95°C for 2 min, (95°C for 30 s, 60°C for 45 s, 72°C for 45 s) × 30, 72°C for 2 min for mouse primer pairs.

In total, 10,000 cells/well were seeded in 96 well-plates 24 h prior to UVC. Initial dosis-finding with increasing UVC irradiation was performed with A375 wildtype cells in between 0 and 500 J/m². Non-UVC-treated cells and wells containing only DMEM served as control and blank, respectively. After 48 h incubation in 100 µL DMEM, 15 µL of MTT dye solution per well were added. After 4 h incubation 100 µL stop solution (MTT dye and stop solution from Promega, Madison, WI, USA) were added, and plates were incubated overnight. Absorptions were captured with Tecan Sunrise (Tecan Trading AG, Männedorf, Switzerland) and the differences between the readings of two wavelengths (550 nm and 650 nm) were indicative of measured cellular metabolic activity. All results were set in relation to the respective non-irradiated cells (set as value 1).

CytoTox96^® non-radioactive cytotoxicity assay (Promega, Sydney, Australia) was used to determine cytotoxicity following the manufacturer’s instructions. Briefly, overnight cultures of A549 cells were treated with increasing concentration of SINE compounds prepared in DMEM containing 2% FBS and 1× PSN. 48 h.p.t, the supernatant was incubated with LDH reagent (Promega) at room temperature for 30 min in the dark, followed by addition of stop solution (Promega) and absorbance was measured at 490 nm. The average optical density (OD) of untreated cells was subtracted from each experimental well. The mean OD values of lysed cells were considered 100% cytotoxic and used to calculate the percent cytotoxicity of SINE compounds. The percent cytotoxicity versus the log10 concentration of SINE compounds was plotted using GraphPad Prism v.8.4.3 and the values were fitted to a non-linear regression curve to determine the 50% cytotoxic concentration (CC₅₀).

Total RNA was extracted from the peeled frozen mouse skin as follows. Frozen mouse skin (20–50 mg) was crushed using a Precellys 24 tissue homogenizer with small beads (CK14) at 5000 rpm for 15 s, using 3 cycles with intervals of 20 s. Crushed tissues were homogenized in 1 ml TRIzole reagent (Invitrogen), and total RNA was isolated according to the manufacturer’s protocol. Aliquots (1 μg) of total RNA were digested with 2 IU of RQ1 RNase-free DNase (Promega) for 30 min at 37 °C and then incubated for 10 min at 65 °C with stop solution (Promega). For reverse transcription, total RNA (0.75 μg) was treated with M-MLV reverse transcriptase (Invitrogen) using random primers (nonadeoxyribonucleotide mixture; pd(N)₉) (Takara bio Inc., Shiga, Japan). Quantitative real-time PCR was conducted using FastStart Essential DNA Green Master and a LightCycler 96 (Roche Applied Science) according to the manufacturer’s protocols. Housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for quantification. The primers used for real-time PCR are listed in Supplementary Table 3.

RNA from human pDCs was isolated using the RNeasy Plus kit (Qiagen) followed by treatment with RQ1 DNase (Promega) for 30 min at 37°C and inactivation with Stop Solution (Promega) for 10 min at 65°C.