Real-time polymerase chain reaction (PCR) was performed to confirm the expression of APOBEC3B messenger RNA (mRNA) in the cell lines. RNA was extracted from each cell using an RNA-spinTM Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Republic of Korea). The extracted RNA was quantified using a NanoDropTM Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and 2 µg of complementary DNA (cDNA) was subsequently synthesized using an AMPEGENE® cDNA Synthesis Kit (Enzo Life Sciences, Farmingdale, NY, USA). Real-time PCR was performed using DNA Master SYBR Green I and Light Cycler 2.0 real-time PCR equipment (Roche, Basel, Switzerland). The primers used for human APOBEC3B were GACCCTTTGGTCCTTCGAC (sense) and GCACAGCCCCAGGAGAAG (antisense). The primers for human β-actin were GTCCACCTTCCAGCAGATGT (sense) and AAAGCCATGCCAATCTCATC (antisense). The detailed experiments were performed as previously described [21 (link)].
Dna master sybr green 1
Manufactured by Roche
Sourced in Switzerland, Germany
DNA Master SYBR Green I is a laboratory reagent used for quantitative real-time PCR analysis. It contains SYBR Green I, a fluorescent dye that binds to double-stranded DNA, enabling the detection and quantification of DNA targets during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (6 mentions)
Rna br assay kit, by Thermo Fisher Scientific (2 mentions)
Superscript vilo kit, by Thermo Fisher Scientific (2 mentions)
Nucleospin rna kit, by Macherey-Nagel (2 mentions)
Lightcycler system, by Roche (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Light cycler 2.0 real time pcr, by Roche (1 mentions)
Rna spin total rna extraction kit, by iNtRON Biotechnology (1 mentions)
Isogen, by Nippon Gene (1 mentions)
Tripure isolation reagent, by Roche (1 mentions)
Lightcycler, by Roche (1 mentions)
5 protocols using dna master sybr green 1
1
Quantifying APOBEC3B mRNA Expression
2
Quantifying COX-2 mRNA Expression in Mouse Hearts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hearts of wild-type mice were excised 6 h after IPC or sham treatment and total RNA was prepared from ischemic and nonischemic areas using Isogen (Nippon Gene, Toyama, Japan). Total RNA (2 μg) was reverse-transcribed, as previously reported (10). The resulting cDNA was amplified by polymerase chain reaction (PCR) using primer sets corresponding to COX-2 mRNA, as follows:
sense 5′-ACACTCTATCACTGGCACCC-3′
antisense 5′-GGACGAGGTTTTTCCAC-CAG-3′
The quantity of PCR product was determined by real-time PCR analysis using Lightcycler apparatus (Idaho Technology, Idaho Falls, ID, USA) and DNA Master SYBR Green I (Roche Molecular Biochemicals, Mannheim, Germany) as previously described [20 (link)]. The values for the ischemic areas were expressed in relation to the nonischemic areas.
sense 5′-ACACTCTATCACTGGCACCC-3′
antisense 5′-GGACGAGGTTTTTCCAC-CAG-3′
The quantity of PCR product was determined by real-time PCR analysis using Lightcycler apparatus (Idaho Technology, Idaho Falls, ID, USA) and DNA Master SYBR Green I (Roche Molecular Biochemicals, Mannheim, Germany) as previously described [20 (link)]. The values for the ischemic areas were expressed in relation to the nonischemic areas.
3
Quantifying mRNA Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA expressions were determined by quantitative real time PCR (qRT-PCR). For this purpose, mRNA was isolated from PBMCs using Tripure Isolation Reagent (Roche Diagnostics, Basel, Switzerland). cDNA was synthesized from 1 μg total RNA using reverse transcriptase with oligo-dT primers. q-RT-PCR was performed using the LightCycler instrument (Roche Diagnostics, Basel, Switzerland) with DNA-master SYBR Green I (Roche Diagnostics, Basel, Switzerland). All PCRs were performed with the same basic program, with one cycle at 95°C for 10 min, followed by 40 cycles at the conditions shown in Table 1 . The primers used for amplification are also shown in Table 1 .
The relative quantification was performed by standard calculations considering 2(-ΔΔCt). Basal mRNA levels at the beginning of the stage were arbitrarily referred to as 1. The expression of the target gene was normalized with respect to ribosomal 18S.
The relative quantification was performed by standard calculations considering 2(-ΔΔCt). Basal mRNA levels at the beginning of the stage were arbitrarily referred to as 1. The expression of the target gene was normalized with respect to ribosomal 18S.
4
RNA Isolation and Real-Time qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation from JPCs was performed using the NucleoSpin RNA kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions. RNA concentration was measured using a Qubit 3.0 fluorometer and the corresponding RNA BR Assay Kit (Thermo Fisher Scientific Inc., Waltham, MA, United States). A total amount of 0.5 μg RNA was used for the first-strand cDNA synthesis using the SuperScript Vilo Kit (Thermo Fisher Scientific Inc., Waltham, MA, United States). The quantification of mRNA expression levels was performed using the real-time LightCycler System (Roche Diagnostics, Mannheim, Germany). For the PCR reactions, commercial primer kits (Search LC, Heidelberg, Germany), and DNA Master SYBR Green I (Roche, Basel, Switzerland) were used. The amplification of cDNAs (Table 1 ) was performed with a touchdown PCR protocol of 40 cycles (annealing temperature between 68 and 58°C), following the manufacturer’s instructions. Copy numbers of each sample were calculated on the basis of a standard curve (standard included in the primer kits) and normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
5
RNA Quantification in Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation from JPCs and iMSCs was performed using the NucleoSpin RNA kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions. RNA concentration was measured using a Qubit 3.0 fluorometer and the corresponding RNA BR Assay Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). Total of 0.5 μg of RNA was used for first-strand cDNA synthesis using the SuperScript Vilo Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). The quantification of mRNA expression levels was performed using the real-time LightCycler System (Roche Diagnostics, Mannheim, Germany). For the PCR reactions, commercial PPARγ, LPL, Leptin, COL2A1, COL10A1, SOX9, COMP, ALP, RUNX2, OCN, COL1A1 primer kits (Search LC, Heidelberg, Germany), and DNA Master SYBR Green I (Roche, Basel, Switzerland) were used. The amplification was performed with a touchdown PCR protocol of 40 cycles (annealing temperature between 68–58 °C), following the manufacturer’s instructions. Copy numbers of each sample were calculated on the basis of a standard curve (standard included in the primer kits), and normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). X-fold induction values were calculated by the quotient of the sample and the corresponding control (iPSCs).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!