Mimic nc

Small interfering RNA (siRNA/si)-circFLNA, si-negative control (NC), miR-199-3p mimic, miR-199-3p inhibitor, NC mimic, NC inhibitor, pcDNA3.1-circFLNA and pcDNA3.1 (empty vector) were purchased from Shanghai GenePharma Co., Ltd. The sequences of the constructs were as follows: si-circFLNA forward, 5′-AGCCCCTTCAGGGAGCTGGCA-3′ and reverse, 5′-CAACAGCCCCTTCAGGGAGCT-3′; pcDNA3.1-circFLNA forward, 5′-GUGCCAGCUCCCUGAAGGGTT-3′ and reverse, 5′-GCCAGCUCCCUGAAGGGGCTT-3′; si-NC forward, 5′-GGTAAGCAGTGGCTCCTCTAA-3′ and reverse, 5′-ACGUGACACGUUCGGAGAATT-3′; miR-199-3p mimic forward, 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse, 5′-AGGGCCCCCCCUCAAUCCUGU-3′; miR-199-3p inhibitor forward, 5′-ACAGGAUUGAGGGGGGGCCCU-3′; NC mimic forward, 5′-CAGUACUUUUGUGUAGUACAA-3′ and reverse, 5′-CAGUACUUUUGUGUAGUACAA-3′; and NC inhibitor forward, 5′-GGUAAGCAGUGGCUCCUCUAA-3′ and reverse, 5′-ACGUGACACGUUCGGAGAAUU-3′. Cells were added in 6-well plates at 1×10⁵ cells/well and were transfected with 20 µM miR-199-3p mimic, miR-199-3p inhibitor, si-circFLNA, pcDNA3.1-circFLNA or respective NCs using Lipofectamine^® 2000 (cat. no. 11668030; Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Following transfection at 37°C for 6 h, the culture medium was replaced and cells were subsequently obtained at 24 h post-transfection for further experiments.

miR-515-5p mimic (UUCUCCAAAAGAAAGCACUUUCUG), NC mimic (UACUGAGAGACAUAAGUUGGUC), pcDNA3.1-chromobox 4 (CBX4) and their respective negative controls (NC mimic and Lv-NC) were designed and obtained from Shanghai GenePharma Co., Ltd. Cell transfection was performed on MCF7 or ZR-75-30 cells using X-Porator H1 (cat. no. EBXP-H1, Etta Biotech Co., Ltd.), according to the manufacturer's protocol. Briefly, the MCF7 and ZR-75-30 cells were collected and resuspended in the electroporation buffer at 270 mOsm osmolarity, 0.1 S/m conductivity (Etta Biotech Co., Ltd.). The cell concentration was then adjusted to 6x10⁵ cells/ml along with mixed 150 nM miRNA mimics and/or 1 mg/ml plasmid. A total of 100 µl cell suspension mixed with RNAs was then added into a 0.4 mm cuvette and used Matrix needle electrodes for gene transfection using the operator H1. The electroporation device was operated at a direct current square wave with a 180-V voltage, 4 nA, 500-µsec duration, 1-sec intervals and three pulses at room temperature Following electroporation, the cells were diluted to appropriate concentrations in MEM supplemented with 1.5 g/l NaHCO₃, 10% FBS and seeded into appropriate cell culture plates at 37˚C with 5% CO₂, for use in further assays at 24 h post-electroporation.