Taqman preamp pool
The TaqMan PreAmp pool is a pre-designed pool of primers and probes that can be used to increase the target gene copy number prior to TaqMan gene expression analysis. The pool is designed to amplify multiple target genes simultaneously, allowing for efficient target enrichment before downstream TaqMan qPCR.
Lab products found in correlation
4 protocols using taqman preamp pool
Optimized TF Human Inflammation Panel Protocol
Profiling miRNA Expression by RT-qPCR
Plasma miRNA Expression Profiling
Quantification of miR-99b-5p in Cells and FFPE
miR-99b-5p: MIMAT0000689; CACCCGUAGAACCGACCUUGCG;
U6 was used as an endogenous reference gene and the data were analyzed using the 2−dCt method. The experiment was repeated three times independently.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!