The largest database of trusted experimental protocols

4 protocols using taqman preamp pool

1

Optimized TF Human Inflammation Panel Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TF Human Inflammation Panel contains 586 validated TaqMan Assays related to human inflammation. The reverse transcription (RT) and preamplification steps were carried out in an Applied Biosystems 2720 Thermal Cycler (Foster City, CA), according to the manufacturer’s instructions for Low Sample Input on TaqMan OpenArray Pathway Panels (Life Technologies, Carlsbad, CA). Two separate gene-specific RT products were generated from 100 ng of each RNA sample using a SuperScript Vilo RT Kit (Invitrogen, Carlsbad, CA) and 2 custom Taqman PreAmp Pools (Applied Biosystems), labeled pool A or pool B (10 minutes at 25°C, 60 minutes at 42°C, and 5 minutes at 85°C). Each RT product was then preamplified using Taqman Preamplification Master Mix (Applied Biosystems), the same custom Taqman PreAmp Pool (A or B), and 14 cycles of preamplification (15 seconds at 95°C and 4 minutes at 60°C). At the end of the preamplification, the products from pools A and B for each sample were mixed thoroughly and then diluted 1:20 with nuclease-free water.
+ Open protocol
+ Expand
2

Profiling miRNA Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression levels of miRNAs were detected by RT-qPCR. Briefly, a fixed volume of 3 μL of miRNA solution was used for reverse transcription using a TaqMan MicroRNA Reverse Transcription Kit and the TaqMan Custom RT pool (Applied Biosystems, CA, USA). For our custom selection, 3.125 μL of reverse transcription reaction was used for preamplification with TaqMan PreAmp Master Mix (2X) and the TaqMan PreAmp pool (Applied Biosystems, CA, USA). The preamplification reaction was diluted with water (1:130) and 5 μL was used for RT-qPCR with TaqMan Universal Master Mix II, no UNG and specific TaqMan MicroRNA assays (Applied Biosystem, CA, USA). Reverse transcription and preamplification reactions were carried out as mentioned above. RT-qPCR reaction was performed with an Applied Biosystems QuantStudio 7 under the following conditions: 50 °C for 2 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The results were normalized using the best ECs identified together with the spike-in control (cel-miR-39-3p).
+ Open protocol
+ Expand
3

Plasma miRNA Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression profiling of 188 miRNAs identified as the most consistent and reliable miRNAs in human plasma14 (link) was performed using TaqMan-Low-Density-Array (TLDA) human custom arrays as instructed by the manufacturer (Applied Biosystem, CA, USA) with Applied Biosystems QuantStudio 7. Briefly, a fixed volume of 3 μL of miRNA solution was used for reverse transcription using a TaqMan MicroRNA Reverse Transcription Kit and the TaqMan Custom RT pool (Applied Biosystems, CA, USA), which were customized for TLDAs. The reaction was performed under the following conditions: incubation for 30 min at 16 °C and 30 min at 42 °C, inactivation for 5 min at 85 °C and immediate cooling to 4 °C. The cDNA was stored at − 20 °C. For our custom selection, 3.125 μL of the reverse transcription reaction was used for preamplification using TaqMan PreAmp Master Mix (2X) and TaqMan PreAmp pool (Applied Biosystems, CA, USA). The reaction conditions were as follows: 10 min at 95 °C, 2 min at 55 °C, 2 min at 72 °C, 12 cycles of 15 s at 95 °C and 4 min at 60 °C, inactivation for 10 min at 99.9 °C and cooling to 4 °C. The preamplification reaction was then diluted with water (1:3), and 4.5 μL was used for TLDA. Reverse transcription and preamplification reactions were carried out with an Applied Biosystems Verity Thermal Cycler. Data were normalized by the mean-centre normalization method.
+ Open protocol
+ Expand
4

Quantification of miR-99b-5p in Cells and FFPE

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) and formalin-fixed paraffin slices using RecoverAllTM Total Nucleic Acid Isolation Kit (AM1975, Ambion®; Life Technologies, Carlsbad, CA, USA), according to the protocol. Quantitative PCR was performed using miRNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA), TaqMan® PreAmp Pools (Applied Biosystems) and LNATM miRNA Quantitative Fluorescence Detection Kit (HaoQin, Shanghai, China) with a Universal ProbeLibrary (Roche, Basel, Switzerland):
miR-99b-5p: MIMAT0000689; CACCCGUAGAACCGACCUUGCG;
U6 was used as an endogenous reference gene and the data were analyzed using the 2−dCt method. The experiment was repeated three times independently.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!