Replication reactions were stopped at the indicated time points with 10 volumes of Stop Solution B (0.5% SDS, 50 mM Tris-HCl [pH 7.5], and 25 mM EDTA [pH 8.0]). The reactions were treated with 0.16 mg/ml RNase A for 1 hr at 37°C, followed by 0.75 mg/ml Proteinase K overnight at room temperature. The reactions were then phenol/chloroform extracted, precipitated, and digested with AflIII (for pICLPt) for 3 hr at 37°C or Nb.BsmI (for pDPC2×Lead) for 1 hr at 65°C. After addition of denaturing PAGE Gel Loading Buffer II (Life Technologies), the radiolabeled nascent strands were resolved on a 7% denaturing polyacrylamide gel, transferred to filter paper, dried, and visualized by phosphorimaging on a Typhoon FLA 7000 (GE Healthcare). To enhance visualization of bands, a logarithmic transform was applied using ImageJ to all nascent strand analyses except those presented in Fig. 2e and Extended Data Figs. 3a, e and 7e . Sequencing gel markers were generating using the Thermo Sequenase Cycle Sequencing Kit (USB Corporation) with primer pICL_Seq that anneals with the pICL plasmids 149 nucleotides upstream of the crosslink.
Page gel loading buffer 2
Manufactured by Thermo Fisher Scientific
PAGE Gel Loading Buffer II is a ready-to-use solution designed for the preparation of samples for polyacrylamide gel electrophoresis (PAGE) analysis. It contains a dye and glycerol to facilitate sample loading and tracking during the electrophoresis process.
Automatically generated - may contain errors
5 protocols using page gel loading buffer 2
1
Nascent Strand Analysis of DNA Replication
2
Nascent Strand Analysis of DNA Replication
3
Nascent Leading Strand Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For nascent leading strand analysis, 3–4 µl of replication reaction was added into 10 volumes of transparent stop buffer (50 mM Tris‐HCl, pH 7.5; 0.5% SDS; 25 mM EDTA). Samples were treated with 2 µl RNase (4 mg/ml) for 30 min at 37°C and 2 µl proteinase K (20 mg/ml) overnight at RT. Replication intermediates were purified by phenol/chloroform extraction and ethanol precipitation and resolved in 8 µl 10 mM Tris‐HCl, pH 8.0, as described previously (Räschle et al, 2008 (link); Knipscheer et al, 2009 (link)). DNA was digested with the indicated restriction enzymes for 2 h at 37°C and supplemented with 0.5 volumes of denaturing PAGE Gel Loading Buffer II (Life Technologies). The digested DNA products were resolved on a 6% polyacrylamide sequencing gel.
4
Nuclease Activity Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclease assay was performed as previously described (De Laat et al, 1998 ). The following primers were obtained (Integrated DNA technologies): SL: 5′‐FAM‐CGCCAG CGC TCGGTTTTTTTTTTTTTTTTTTTTTTCCGAGCGCTGGC‐'3; F1: 5′‐FAM‐ CGCGATGCGG ATCCAA‐3′; F2: 5′‐CCTAGACTTAAGAGGCCAGACTTGGATCCGCATCGC‐3′; F3: 5′‐GGCCTCTTAAGTCTAGG‐3′. For the stem‐loop structure, primer SL was heated for 3 min at 95°C, followed by stepwise cooling to allow annealing (30 min at 60°C, 30 min at 37°C, 30 min at 25°C, 30 min on ice). To assemble the 3′ flap substrate, primer F1 was annealed to primer F2 and F3 in a 1:1:1 ratio and annealed similar to the stem‐loop substrate. Nuclease reactions (15 μl) were carried out in nuclease buffer (50 mM Tris pH 8.0, 0.2 mM MnCl2, 0.1 mg/ml bovine serum albumin, and 0.5 mM β‐mercaptoethanol) containing 100 nmol of substrate DNA and 10–100 nM of recombinant XPF‐ERCC1 wild‐type or mutant protein complex. Reactions were incubated for 30 min at room temperature and stopped by addition of 15 μl denaturing PAGE Gel Loading Buffer II (Life Technologies, Inc.). Samples were heated to 72°C for 3 min, snap‐cooled, and loaded onto a 12% denaturing urea–PAGE gel. Gels were directly measured on a Typhoon phosphor imager (GE Healthcare) on the blue 488 channel.
5
Purification and Separation of Replication Intermediates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For nascent leading strand analysis, 3-4 μL of replication reaction were added to 10 volumes of transparent stop buffer (50 mM Tris-HCl, pH 7.5, 0.5% SDS, 25 mM EDTA), and replication intermediates were purified as previously described (Knipscheer et al., 2009 (link); Räschle et al., 2008 (link)). DNA was digested with the indicated restriction enzymes and supplemented with 0.5 volumes of denaturing PAGE Gel Loading Buffer II (Life technologies). The digested DNA products were resolved on either a 6 or 7% polyacrylamide sequencing gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!