Neonatal rat primary microglia isolated from mixed glial cultures were seeded onto poly-l -lysine-pretreated 24-well plates at 2 × 105 cells per well and grown in culture medium for microglia (RPMI 1640 medium supplemented with 10% FCS, 1 mM l-glutamine, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 50 mM β-mercaptoethanol, 100 U ml−1 penicillin, and 100 mg ml−1 streptomycin). The cells were allowed to attach overnight. A total of 100 nM of miR-210 mimic (Qiagen), negative mimic (Qiagen), LNA-anti-miR-210 (Exiqon), LNA scramble control (Exiqon), On-Target plus rat SIRT1 siRNA (Dharmacon), or control siRNA (Dharmacon) were used for in vitro transfection. Primary microglia transfection was performed with HiPerfect transfection reagent (Qiagen) according to the manufacturer’s instructions. For microglia M1 activation, cells were recovered overnight after 6 h transfection and then stimulated by adding LPS (0.5 ng/ml, Sigma) and IFN-γ (0.1 ng/ml, PeproTech). At the desired time points, microglia were collected for analysis.
Negative mimic
Manufactured by Qiagen
The Negative mimic is a laboratory equipment product designed to serve as a control sample for nucleic acid amplification techniques. It provides a negative control, allowing researchers to evaluate the specificity and sensitivity of their assays. The Negative mimic is intended to be used in conjunction with other laboratory procedures and equipment as part of a comprehensive quality control process.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Mir 210 mimic, by Qiagen (2 mentions)
Hiperfect transfection reagent, by Qiagen (2 mentions)
Synthetic mir 1946a mimic, by Qiagen (2 mentions)
Lna anti mir 210, by Qiagen (1 mentions)
Lna scramble control, by Qiagen (1 mentions)
Ifn γ, by Thermo Fisher Scientific (1 mentions)
Control sirna, by Horizon Discovery (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
Dual luciferase reporter assay, by Promega (1 mentions)
Phenol chloroform isoamyl alcohol, by Thermo Fisher Scientific (1 mentions)
Complete lysis buffer, by Active Motif (1 mentions)
Mirna target ip kit, by Active Motif (1 mentions)
5 protocols using negative mimic
1
Microglia Activation Modulation Protocol
2
Regulation of TGFβ1 3'UTR by miR-1946a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 50,000 cells/well of PLFs were seeded in 96-well plates. PLFs were co-transfected with either luciferase reporter plasmid (pEZX-MT05) containing TGFβ1 3′UTR/Renilla luciferase plasmid or control plasmid/Renilla luciferase plasmid (Genecopoeia, Rockville, MD) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol. Twenty-four hours after plasmid transfection, cells were transfected with synthetic miR-1946a mimic (5 nM) or negative mimic (5 nM) from Qiagen as outlined above. Forty-eight hours later, a dual-luciferase reporter assay was performed (Promega Corp., Madison, WI), TGFβ1 3′ UTR luciferase activity values were expressed as ratios of arbitrary units of firefly luciferase/renilla luciferase activity.
3
Transfection of miR-142-3p mimic and inhibitor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miScript miR-142-3p mimic, inhibitor, and negative mimic were purchased from (Qiagen, New Taipei City, Taiwan). DLD1 and HCT116 cells were seeded at 3 × 105 cells/well in six-well plates and transfected using Invitrogen® LipofectamineTM 2000 (cat. no. 11668019, Thermo Fisher Scientific., Carlsbad, CA, USA) according to the manufacturer’s protocol. After transfection, cells were harvested and further analyzed.
4
Assessing miR-1946a's Role in TGFβ1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess whether miR-1946a mediates TGFβ1 expression, PLFs were transfected with synthetic miR-1946a mimic (5′AGCCGGGCAGUGGUGGCACACACUUUU; 5 nM, Qiagen, Valencia, CA), negative mimic (5 nM, Qiagen, Valencia, CA), anti-mmu-miR-1946a (miR-1946a inhibitor, 20 nM, Qiagen, Valencia, CA), or anti-miR negative control (20 nM, Qiagen, Valencia, CA) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol. Six hours after transfection, serum-free media was replaced with DMEM culture media supplemented with 5% FBS, and cells were incubated overnight. PLFs were treated with alcohol (60 mM) 24 h after transfection, and then continued incubation in culture media supplemented with 5% FBS for 24 or 72 h for gene and protein analysis (or 48 h after miR-1946a mimic or miR-1946a inhibitor treatment).
5
Rat Microglia miR-210 Regulation of SIRT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immortalized rat microglia (Applied Biological Materials) were seeded onto collagen I-pretreated 6-well plates (Thermo Fisher) at 6 × 105 cells per well and transfected with 100 nM of either miR-210 mimic (Qiagen) or negative mimic (Qiagen) by using HiPerfect transfection reagent (Qiagen) according to the manufacturer’s instructions. Cells were harvested 24 h after transfection and washed in ice-cold PBS followed by complete lysis buffer (Active Motif) at 4 °C for 10 min. RISC-IP of the lysate was conducted using the miRNA Target IP Kit (Active Motif) following the manufacturers’ instructions. The RNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1, Fisher Scientific) once, chloroform once and precipitated and resuspended in RNase-free water. The precipitated RNA was subjected to RT-qPCR using primers specific for the rat SIRT1 3′UTR. β-actin was used as an internal control. The relative abundance of SIRT1 transcript pulled down by Ago1/2/3 antibody was calculated by the 2−ΔΔCT method and is presented as the fold induction relative to the control. Primers are presented in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!