T7 dna ligase

All plasmids within this study were created using the MoClo Yeast Toolkit (YTK) system (Lee et al., 2015 (link)). Additional sequences not included within the YTK system that were used within this study can be found in the Table S3. For a list of all plasmid constructs used in this study, see Table S4. Unless indicated, part sequences were either mutated or synthesized to remove or avoid all instances of the BsmBI, BsaI, BpiI, and NotI recognition sequences.
Construction of all plasmid constructs in Table S4 was achieved using Golden Gate assembly. All parts were set to equimolar concentrations of 50 fmol/μL (50 nM) prior to experiments. Golden Gate reactions were prepared as follows: 0.1 μL of backbone vector, 0.5 μL of each plasmid, 1 μL T4 DNA ligase buffer (Promega), 0.5 μL T7 DNA Ligase (NEB), 0.5 μL restriction enzyme (BsaI or BsmBI) (NEB), and water to bring the final volume to 10 μL. Reaction mixtures were then incubated in a thermocycler using the following program: (42°C for 2 min, 16°C for 5 min) x 25 cycles, followed by a final digestion step of 60°C for 10 min, and then heat inactivation at 80°C for 10 min. The entire reaction mixture was then transformed directly into E. coli and plated on LB medium with the appropriate antibiotics.

Thermus thermophilus (Tth) DNA ligase (sold under the name Thermus aquaticus (Taq) DNA ligase by New England Biolabs for historical reasons), PBCV-1 DNA ligase (sold as SplintR ligase by New England Biolabs), T3 DNA ligase, T4 DNA ligase, T7 DNA ligase, 2 M KCl, 1 M MgCl₂, 1 M DTT, 10 mM ATP, and 50 mM NAD⁺ were obtained from New England Biolabs (Ipswich, MA). Tris-HCl (1 M pH 7.5 @ 25°C) was obtained from Amresco (Solon, OH). Triton X-100 (10%) was obtained from Sigma-Aldrich (St Louis, MO). Tth DNA ligase buffer (20 mM Tris-HCl pH 7.5 @ 25°C. 25 mM KCl, 10 mM MgCl₂, 1 mM NAD⁺, 10 mM DTT, and 0.1% Triton^® X-100) was prepared as a 10X stock. T4/PBCV-1 DNA ligase buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP, 10 mM MgCl₂, and 10 mM DTT) was prepared as a 5X stock. Oligonucleotide annealing buffer (10 mM Tris pH 7.5 @ 25°C, 50 mM KCl, 0.1 mM EDTA) was prepared as a 10X stock. Ligase reaction quench (50 mM EDTA, 0.1% Triton^® X-100) was prepared at 1X.

For overexpression of PARP‐1, MSCs were transduced with PLAS2w vector carrying full length PARP‐1 gene from National Yang‐Ming University VYM Genome Research Center. In brief, PLAS2w plasmid was digested by SbfI/AgeI restriction enzymes (New England Biolabs; Ipswich MA; https://www.neb.com/) and the full length of PARP‐1 gene was ligased by T7 DNA ligase (New England Biolabs). Viral production of the constructed plasmid with lentivirus system was performed by National Science Council RNAi core facility, Academia Sinica, Taiwan.

Antibodies to RyR (pan-specific), AHCY, AHCYL1, and β-actin, and mouse IgG-κ binding protein conjugated to CFL 488 were from Santa Cruz Biotechnology (Dallas, TX). Goat anti-mouse IgG conjugated to IRDye 680RD and goat anti-rabbit IRDye 800CW were from LI-COR (Lincoln, NE). Antibodies to phosphatidylinositol 4,5 bisphosphate (PIP₂) were from Echelon Biosciences (Salt Lake City, UT). Goat anti-mouse IgG conjugated to horseradish peroxidase was from BioRad (Hercules, CA). ERK1/2 and pERK1/2 antibodies were from Cell Signaling Technology (Danvers, MA). Oligonucleotides encoding gRNA and primers were obtained from Integrated DNA Technologies (Coralville, IA). The pSpCas9(BB)-2A-Puro (PX459) V2.0 vector was a gift from Feng Zhang (Addgene plasmid # 62988). T4 polynucleotide kinase and T7 DNA ligase were from New England Biolabs (Ipswich, MA). Fast AP thermosensitive alkaline phosphatase and FastDigest Bpil were from Thermo Scientific (Waltham, MA). Plasmid-Safe ATP-Dependent DNase was from Lucigen (Middleton, WI). Surveyor Mutation Detection Kit S100 was from Integrated DNA Technologies (Coralville, IA).
Chemicals- Fura-2 AM was from Invitrogen (Carlsbad, CA). Xestospongin C was from Cayman Chemical (Ann Arbor, MI). All other reagents, unless otherwise indicated, were from Sigma-Aldrich (St. Louis, MO).

The chloramphenicol-selectable, high-copy plasmid pSB1C3 (BioBricks Foundation) was used as a backbone to construct the standard entry vector for GoI insertion (Supplementary Fig. 1C). To construct this vector we first PCR amplified pSB1C3 (Forward: taagccagccccgacacccg, Reverse: tgaaccacagagtgattaat) and lacZ under control of pLac promoter flanked by BsaI restriction sites (Forward: gcagctggcacgacaggttt, Reverse: ttatgcggcatcagagcaga). Second, the linker-mKate sequence was codon optimised and ordered for synthesis by GeneArt with the RBS sequences BCD2 and B0034. The different parts were then assembled and cloned using the Gibson Assembly method^{59 (link)} to obtain the standard entry vector described in Supplementary Fig. 1C.
The selected GoI (Supplementary Table 2) were all obtained from BioBrick format DNA from the iGEM Parts Registry. This was used as template and PCR amplified to be flanked by appropriate BsaI restriction sites (ggtctcannnn). Golden Gate assemblies were setup by pipetting 40 fmol of backbone and insert, 0.5 µl of BsaI (NEB UK), 0.5 µl of T7 DNA ligase (NEB UK), 1 µl T4 buffer (NEB UK) and completed with water for final volume of 10 µl. Then the mix was put in a thermocycler for 30 following cycles: 42 °C for 2 min/6 °C for 5 min/55 °C for 1 h/80 °C for 10 min.