Pet28a, which is a widely used expression vector for the production of recombinant protein, was used in the present study. Briefly, CdtB gene was amplified using forward 5′ TAAGCACATATGATGAAAAAACCTGTTTTTTT 3′ and reverse primer 5′ TGCTTAAAGCTTTTAACAGCTTCGTGCCAAAA3′ having sites for HindIII and NdeI restriction enzymes, respectively. Amplified CdtB gene and vector were digested using thermo fast digest HindIII and NdeI enzymes. After digestion, both vector and gene were gel purified and ligation was done using Takara T4 DNA ligase enzyme at 16 °C for 30 min. Transformation of recombinant DNA was done into E.coli BL21(DE3) host cells using CaCl2 method26 . Transformed cells obtained on kanamycin-containing Luria-agar plates were checked for the presence of recombinant plasmid by extracting plasmid by alkaline lysis method. To confirm the integrity of the inserted DNA into the pET28a plasmid nucleotide sequencing analysis was also done. The vector was extracted from transformed BL21 (DE3) E.coli cells, purified using Qiagen gel purification kit and was sequenced using T7 promoter and terminator primers.
T4 dna ligase enzyme
Manufactured by Takara Bio
Sourced in China, Japan
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate ends in double-stranded DNA molecules. It is commonly used in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
5 protocols using t4 dna ligase enzyme
1
Expression and Purification of CdtB Protein
2
Cloning Pluripotency Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Open reading frames of Oct4, Sox2, Klf4 and c-Myc (OSKC) factors were amplified by PCR using PrimeSTAR® Max DNA Polymerase (DR045A, Takara, Dalian, China) and primers sets (Table 1 ) in which the cutting sequences of EcoRI and XhoI enzymes were added to the 5' end of the forward and reverse primers respectively. The primers were synthesized by Life Technologies Co., Ltd. (Shanghai, China). The produced amplicons as well as the used expression vector (pCDNA3) were digested by EcoRI and XhoI then purified using an universal DNA purification kit (DP214, TIANGEN, Beijing, China) and finally ligated to each other using T4 DNA ligase enzyme (2011A, Takara, Dalian, China) according to the manufacturer’s protocol. The newly formed recombinant plasmids were cloned in DH5α-E. coli competent cells and re-extracted using TIAN prep Mini plasmid Kit (DP103, TIANGEN, Beijing, China).
3
Silencing MED26b Transcripts in Tomato
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation and cDNA synthesis were performed as previously described [74 (link)]. The MED26b fragments (Solyc10g080930.2) were amplified from the cDNA of Moneymaker leaves via specific primers MED vigs-F and MED vigs-R (Table S1 ). The PCR product and pTRV2 vector, which were digested by BamHI and XhoI restriction enzymes and recovered were ligated with T4 DNA ligase enzyme (Takara, Beijing) overnight at 16 °C and transformed into E. coli DH5α. The recombinant of pTRV2-MED26b was verified using PCR with a bacterial solution using the primers vigs-F and vigs-R (Table S1 ).
4
Construction of Mutant and Complementary Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The construction of mutant and complementary strains was carried out following the method of GUI et al. (2021) (link), with slight modifications. Using the genomic DNA of R. solanacearum as a template, the upstream 440 bp and downstream 469 bp fragments of Rs_T3E_Hyp14 were amplified by specific primers (F1:5′-TCAACCGCAGCTACATCAGCTGCATG-3′,R1:5′-GTTACCGGACAGCGAAGAGCCAGCATTTGTGCAACTCCGTTACTGAGATCG-3′,F2:5′-CGATCTCAGTAACGGAGTTGCACAAATGCTGGCTCTTCGCTGTCCGGTAAC-3′,R2:5′-AAGAGCCGCTCTTTGCACTCCGATCA-3′). The upstream and downstream fragments were linked by overlapping PCR, digested by restriction enzymes XbaI and SphI (Takara, Shiga, Japan), and then ligated into the PK18 vector (PK18-U-D) by T4 DNA ligase enzyme (Takara, Shiga, Japan) and transformed into R. Solanacearum FJ1003, by homologous recombination. The Rs_T3E_Hyp14 in R. solanacearum was removed, and the Rs_T3E_Hyp14 mutant (ΔRs_T3E_Hyp14) was obtained that was confirmed by specific primers. For the complementary strains of Rs_T3E_Hyp14, the fragment U-Rs_T3E_Hyp14-D was amplified from the genomic DNA of R. solanacearum by the F1 and R2 primers. The fragment “U-Rs_T3E_Hyp14-D” was ligated into the PK18 vector (PK18-U-Rs_T3E_Hyp14-D) by T4 DNA ligase enzyme and transformed into the mutant strain. The complementary strain (CRs_T3E_Hyp 14ΔRs_T3E_Hyp14) was obtained by homologous recombination.
5
Cloning and Transformation of DNA Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA fragment as the result of gel purification was connected with pGEM-T Easy cloning vector. The compositions of ligation reactor were 5 µL of DNA solution, 0.5 µL of pGEM-T Easy, 6.5 µL of 5x ligation buffer, and 1 µL of T4 DNA ligase enzyme (TAKARA). The incubation was performed for two hours at room temperature, then was incubated overnight in the chiller at 4 °C. Amount 6.5 µL of the result of ligation reaction was mixed into the microtube with competent cells. The DNA transformation was performed by using heat shock at 42 °C for 60 sec. After that, the sample was incubated onice for two to three mins, then 900 µL of SOC solution was put into the microtube. Afterward, the microtube with bacteria of the transformation result was incubated at 37 °C for an hour. Then the bacteria were spread on the petri disc SOB agar media contained IPTG, X-gal, and ampicillin, and was incubated at 37 °C, overnight.
The white colony that grew on the SOB agar media was taken up by using a steril toothpick and was put into a test tube with SOB media contained 100 μL/mL of ampicillin. The plasmid bacteria colony was isolated by using an alkaline lysis solution mini preparation technique (Sambrook & Russell, 2001) .
The white colony that grew on the SOB agar media was taken up by using a steril toothpick and was put into a test tube with SOB media contained 100 μL/mL of ampicillin. The plasmid bacteria colony was isolated by using an alkaline lysis solution mini preparation technique (Sambrook & Russell, 2001) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!