Trans lentiviral shrna packaging kit with calcium phosphate transfection reagent

Manufactured by Horizon Discovery

The Trans-Lentiviral shRNA Packaging Kit with Calcium Phosphate Transfection Reagent is a lab equipment product that provides the necessary components for the production of recombinant lentiviral particles. The kit includes a calcium phosphate transfection reagent, which is used to transfect HEK293T cells with plasmids encoding the lentiviral packaging system and the shRNA of interest.

Automatically generated - may contain errors

Lab products found in correlation

Plvx ires mcherry vector, by Takara Bio (1 mentions) Gipz lentiviral shrna vector, by Horizon Discovery (1 mentions) Plvx ires puro vector, by Takara Bio (1 mentions) Psicor vector, by Addgene (1 mentions)

Spelling variants of this product

Transfection reagent (21 citations)

2 protocols using trans lentiviral shrna packaging kit with calcium phosphate transfection reagent

Lentiviral Overexpression of IRF8 in DLBCL

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral transfection of the LentiORF-IRF8 clone into DLBCL cell lines was used to upregulate IRF8 expression. The CCSB-Broad LentiORF-IRF8 clone and Trans-Lentiviral shRNA Packaging Kit with Calcium Phosphate Transfection Reagent (including Precision LentiORF RFP Control DNA and HEK293 cells) were purchased from Dharmacon. The sequences for the IRF8 ORF were as follows: forward, 5′–CGCAAATGGGCGGTAGGCGTG–3′ and reverse 5′–TACGGGAAGCAATAGCATGA–3′. The ORFs were cloned into pLX304-Blast-V5 vectors. ORF plasmid transfection was performed using procedures similar to those described for shRNA transfection.

Zhong W.J., Xu X., Zhu Z.G., Du Q.H., Du H., Yang L., Ling Y.Y., Xiong H.B, & Li Q.S. (2017). Increased expression of IRF8 in tumor cells inhibits the generation of Th17 cells and predicts unfavorable survival of diffuse large B cell lymphoma patients. Oncotarget, 8(30), 49757-49772.

+ Open protocol

+ Expand

Inducible and Constitutive Gene Silencing Vectors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Inducible shRNAs against TP53 and Trp53 (human and murine p53) or renilla (R) were cloned into the TRMPV-Neo vector (pSIN-TRE-dsRed-miR30-PGK-Venus-IRES-NeoR) as previously described (Weissmueller et al., 2014 (link), Zuber et al., 2011 (link)). Constitutive expression of shRNAs against polyC exons for the isoforms were cloned into the pSicoR vector (Addgene, 11579) as previously described (Ventura et al., 2004 (link)). Constitutive expression of shRNAs against hnRNPK were cloned into the GIPZ Lentiviral shRNA vector (Dharmacon). shRNA sequences are described in Key Resource Table.Constitutive expression of cDNAs encoding for +polyC and −polyC GAPs and indirect regulators of GTPase signaling shRNAs were cloned into the pLVX-IRES-mCherry vector (Clontech 631237). Constitutive expression of cDNAs encoding for human TP53 wild-type and mutants (R175H; R248Q and R273H) were cloned into the pLVX-IRES-PURO vector (Modified from Clontech 631237). All constructs were verified by sequencing. Lentiviruses and retroviruses were produced by transiently transfecting shRNAs or cDNA constructs using the Dharmacon Trans-Lentiviral shRNA Packaging Kit with Calcium Phosphate Transfection Reagent protocols into 293T cells and harvesting viral supernatants 48 h after transfection.

Escobar-Hoyos L.F., Penson A., Kannan R., Cho H., Pan C.H., Singh R.K., Apken L.H., Hobbs G.A., Luo R., Lecomte N., Babu S., Pan F.C., Alonso-Curbelo D., Morris JP I.V., Askan G., Grbovic-Huezo O., Ogrodowski P., Bermeo J., Saglimbeni J., Cruz C.D., Ho Y.J., Lawrence S.A., Melchor J.P., Goda G.A., Bai K., Pastore A., Hogg S.J., Raghavan S., Bailey P., Chang D.K., Biankin A., Shroyer K.R., Wolpin B.M., Aguirre A.J., Ventura A., Taylor B., Der C.J., Dominguez D., Kümmel D., Oeckinghaus A., Lowe S.W., Bradley R.K., Abdel-Wahab O, & Leach S.D. (2020). Altered RNA splicing by mutant p53 activates oncogenic RAS signaling in pancreatic cancer. Cancer cell, 38(2), 198-211.e8.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!