Rotor gene q 5plex hrm platform

Genomic DNA (DNA) was extracted from koala urogenital and ocular swabs using QIAamp DNA minikit (Qiagen, Valencia, CA) as previously described^{41 (link)}. The extracted DNA was screened for the presence of C. pecorum using a species-specific quantitative real-time PCR (qPCR) that targeted the 16 S rRNA gene^{41 (link)} (Supplementary Table S6). The reaction mix contained: 5–50 ng DNA; 1x QuantiTect SYBR Green PCR Master Mix (Qiagen, Valencia, CA); and 10 µM of each primer made up to a final volume of 25 µL with molecular grade water. Thermocycling was performed on a RotorGeneQ 5-plex HRM platform (Qiagen, Valencia, CA) using a 15-minute initial denaturation at 94 °C followed by 40 cycles at: 94 °C for 15 seconds; 57 °C for 30 seconds; 72 °C for 25 seconds for amplification.

Genomic DNA (gDNA) was extracted from whole blood using REDExtract-N-Amp Blood PCR Kit (Sigma Aldrich). Total gDNA (proviral load) load was then quantified using Tarlinton et al.^{21 (link)} conserved primers (Table 1) using QuantiNova SYBR green kit (Qiagen) as per manufacturer’s conditions. β-actin PCR was performed in parallel with KoRV PCR as a control for DNA quality and to provide relative copy numbers by normalization using this gene. Standards for β-actin and KoRV of known concentration of 10², 10⁴, 10⁶ and 10⁸ copy number of the target gene sequence^{12 (link)} were prepared as follows. DNA was extracted from a known KoRV positive koala samples and amplified by PCR. The PCR products were electrophoresed in a 2% agarose/TBE (45 mM Tris-borate and 1 mM EDTA, pH 8.0) gel, stained with ethidium bromide (0.5 ug ml⁻¹) and then visualized on a UV transilluminator. The DNA then purified using the High Pure PCR Product Purification Kit (Roche, Applied Science, Germany). Spectrophotometric measurement of absorbance at 260 and 280 nm wavelengths was used to determine the concentration of DNA in the purified preparations. Avogadro’s formula was used to calculate the number of molecules of the product. All reactions were carried out on a Rotor-Gene Q 5-plex HRM platform (Qiagen).

cDNA was amplified for miRNA, mRNA, and lncRNA expression using miScript primer assay for miRNA amplification (Hs_miR-137_1 and Hs_miR-106b-5p_1 miScript primer assay) and Quantitect primer assays for mRNAs (Hs_FTHL17_1 and Hs_ANAPC11_1_SG QuantiTect primer assays) and lncRNA (RT²_CTB89H12.4 primer assay). The Hs_RNU6-2_11 and Hs_GAPDH genes were used as reference housekeeper genes. The thermal cycling was adjusted according to manufacture instructions. The PCR analysis was conducted on Rotor-Gene Q 5plex HRM Platform (Qiagen, Hilden, Germany). The fluorescence data were collected at the extension step. Following amplification, gene expression was calculated using the 2^∆∆Ct method.

The cochlear tissue was dissected in cold-PBS and homogenized with the Qiazol lysis reagent (Qiagen, Hilden, Germany). A high pure RNA isolation kit (Roche Diagnostic, GmbH, Germany) was used to isolate the total RNA in the homogenate according to the manufacturer’s protocol. The RNA concentration was evaluated with a spectrophotometer (Shimadzu UV-mini 1240, GmbH, Germany). The complementary DNA (cDNA) was synthesized using a transcriptor high fidelity cDNA synthesis kit (Roche Applied Science, Penzberg, Germany). Each prepared sample used 20 μL of the SYBR green qPCR reaction kit (Roche Applied Science), which contained 2 μL of cDNA for qRT‐PCR using the following primer pairs: CASP-3, forward 5’-GGAGCAGCTTTGTGTGTGTG-3’ and reverse 5’-CTTTCCAGTCAGACTCCGGC-3’; BAX, forward 5’-GTTTCATCCAGGATCGAGCAG-3’ and reverse 5’-CATCTTCTTCCAGATGGTGA-3’; BCL-2, forward 5’-CCTGTGGATGACTGAGTACC-3’ and reverse 5’-GAGACAGCCAGGAGAAATCA-3’; GAPDH, forward 5’-CTTCCGTGTTCCTACCCCCAATGT-3’ and reverse 5’-GCCTGCTTCACCACCTTCTTGATG-3’. The GAPDH sequences were used for normalization, as it represents a housekeeping gene. The rotor-gene Q 5plex HRM platform (Qiagen, Hilden, Germany) was used for the qRT-PCR, and the data were analyzed using the comparative Ct method (^ΔΔC_T).

Viral RNA was extracted from the plasma using the Qiagen viral RNA mini kit (Qiagen). Contaminating DNA removal and cDNA synthesis of RNA prepared from plasma was conducted using QuantiTect Reverse Transcription kit (Qiagen). Total cDNA (viral RNA load) load was then quantified using Tarlinton et al.^{21 (link)} conserved primers (Table 1) using QuantiNova SYBR green kit (Qiagen) as per manufacturer’s conditions.
Standards of known concentration of 10², 10⁴, 10⁶ and 10⁸ copy number of the target gene sequence^{12 (link)} were prepared as follows. cDNA was prepared, as above, from a known KoRV positive koala samples and amplified by PCR. The PCR product was electrophoresed in a 2% agarose/TBE (45 mM Tris-borate and 1 mM EDTA, pH 8.0) gel, stained with ethidium bromide (0.5 ug ml⁻¹) and then visualized on a UV transilluminator. The DNA then purified using the High Pure PCR Product Purification Kit (Roche, Applied Science, Germany). Spectrophotometric measurement of absorbance at 260 and 280 nm wavelengths was used to determine the concentration of DNA in the purified preparations. Avogadro’s formula was used to calculate the number of molecules of the product. All reactions were carried out on a Rotor-Gene Q 5-plex HRM platform (Qiagen).

Total RNA was extracted from roots and shoots using a Qiagen Plant RNeasy Kit according to the manufacturer’s instruction (Qiagen, Hilden; Germany). cDNA was synthesized from 1 µg of total RNA using iScript cDNA Synthesis Kit (BIO-RAD Laboratories, Inc, 2000 Alfred Nobel Drive, Hercules, CA; USA) according to the instructions in the user manual. For mycorrhizal samples single-strand cDNA was synthesized from 1 µg of total RNA using Super-Script II (Invitrogen) according to the instructions in the user manual. Primers used for real-time quantitative RT-PCR (qRT-PCR) analysis are listed in (Supplementary Data 4). qRT-PCR was performed using SYBR Green Master Mix (Applied Biosystems; www.lifetechnologies.com) in a StepOnePlus (Life Technologies, Carlsbad, CA, USA). For mycorrhizal samples qRT-PCR was performed using a Rotor-Gene Q 5plex HRM Platform (Qiagen, Hilden; Germany). The 2-^ΔΔC_T method was used to calculate the relative gene expression levels^{39 (link)} and rice Ubiquitin (OsUBQ or OsRubQ1) gene (Supplementary Data 4) was used as the internal control to normalize target gene expression.

DNA was extracted from the ocular and urogenital swabs using a QIAmp DNA mini kit as per manufacturer’s instructions (Qiagen). Extracted DNA was then screened for C. pecorum chlamydial presence and load using quantitative real-time PCR (qPCR). The forward primer: 5’ AGTCGAACGGAATAATGGCT 3’, and the reverse primer: 5’ CCAACAAGCTGATATCCCAC 3’ were used for targeting a 204bp fragment of the C. pecorum 16S rRNA gene. All procedures were as previously described by Marsh et al. (2011) [20 (link)] except for the PCR mixture containing 1 x Quantitect SYBR Green PCR mastermix (Qiagen) and 10 μM primers (Sigma) made up to a final volume of 15 μl with PCR-grade water and an initial denaturation of 15 minutes at 94°C. All reactions were performed in duplicate and samples of ≥ 50 copies/μL were considered positive. All reactions were carried out on a Rotor-Gene Q 5-plex HRM platform (Qiagen).