Log In Sign up
The largest database of trusted experimental protocols

Anti mouse irf5

Manufactured by Cell Signaling Technology
Visit Supplier

Anti-mouse IRF5 is a primary antibody that recognizes the mouse Interferon Regulatory Factor 5 (IRF5) protein. IRF5 is a transcription factor that plays a role in regulating the expression of genes involved in immune and inflammatory responses.

Automatically generated - may contain errors

Lab products found in correlation

Anti human irf5, by Santa Cruz Biotechnology (2 mentions) Sc 390364, by Santa Cruz Biotechnology (2 mentions) Sc 21749, by Santa Cruz Biotechnology (2 mentions) Anti t bet, by Santa Cruz Biotechnology (2 mentions)

2 protocols using anti mouse irf5

1

Transcription Factor Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
ONP assays were conducted as previously described 51 (link). Briefly, nuclear extracts were
precleared with streptavidin-agarose beads and then incubated with biotinylated
double-stranded oligonucleotide containing potential IRF binding site within the
ATAC-seq peak at the Cxcl10 Cluster
(5′-CATAGAAAATGTTTTCAAAACCCGCATTCCGCTTATGCTGTCTGGTATCTGAAATAGATCTGTCAGGGGGTCACATTTTATAAGCACCACTTCGTGTTTG-3′)
or Il6 TSS (trimerized 5′-
TGCTGAGTCACTTTTAAAGAAAAAAAGAAGAGT-3′). Proteins bound to the
biotin-labeled DNA were collected by streptavidin-agarose beads, separated by 8%
SDS-PAGE, and analyzed by immunoblotting using anti-mouse IRF5 (Cell signaling),
anti-human IRF5 (Santa Cruz SC-390364) or an anti-T-bet (Santa Cruz; sc-21749)
antibodies.
Manni M., Gupta S., Ricker E., Chinenov Y., Park S.H., Shi M., Pannellini T., Jessberger R., Ivashkiv L, & Pernis A.B. (2018). Regulation of Age-associated B cells by IRF5 in systemic autoimmunity. Nature immunology, 19(4), 407-419.
+ Open protocol
+ Expand
2

IRF5 and T-bet Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
ONP assays were conducted as previously described 51 (link). Briefly, nuclear extracts were
precleared with streptavidin-agarose beads and then incubated with biotinylated
double-stranded oligonucleotide containing potential IRF binding site within the
ATAC-seq peak at the Cxcl10 Cluster
(5′-CATAGAAAATGTTTTCAAAACCCGCATTCCGCTTATGCTGTCTGGTATCTGAAATAGATCTGTCAGGGGGTCACATTTTATAAGCACCACTTCGTGTTTG-3′)
or Il6 TSS (trimerized 5′-
TGCTGAGTCACTTTTAAAGAAAAAAAGAAGAGT-3′). Proteins bound to the
biotin-labeled DNA were collected by streptavidin-agarose beads, separated by 8%
SDS-PAGE, and analyzed by immunoblotting using anti-mouse IRF5 (Cell signaling),
anti-human IRF5 (Santa Cruz SC-390364) or an anti-T-bet (Santa Cruz; sc-21749)
antibodies.
Manni M., Gupta S., Ricker E., Chinenov Y., Park S.H., Shi M., Pannellini T., Jessberger R., Ivashkiv L, & Pernis A.B. (2018). Regulation of Age-associated B cells by IRF5 in systemic autoimmunity. Nature immunology, 19(4), 407-419.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!