RNA extraction from cells was done using Trizol (Life Technologies, Carlsbad, CA) and extracted RNA was treated with DNase I (Promega, Madison, WI). 2 μg of total RNA was reverse transcribed with MultiScribe TM MuLV reverse transcriptase (LifeTechnologies, Carlsbad, CA). 40 ng cDNA was used for quantitative polymerase chain reaction (PCR) amplification (Life Technologies, Carlsbad, CA) with 2X SYBR green PCR master mix (Life Technologies, Carlsbad, CA). Negative controls were included in samples where no reverse transcriptase was added for each RNA sample. The relative gene expression levels were normalized according to those of Hprt1 and/or 18S rRNA. Relative fold expressions were calculated using the comparative Ct method (Life Technologies, Carlsbad, CA). Standard deviations were calculated from the mean of the ΔCt values calculated from at least three independent RNA samples. Primers used are listed in S1 Table .
Multiscribe mulv reverse transcriptase
Manufactured by Thermo Fisher Scientific
Sourced in United States
MultiScribe™ MuLV reverse transcriptase is a recombinant reverse transcriptase derived from Moloney Murine Leukemia Virus (M-MuLV). It catalyzes the conversion of single-stranded RNA into complementary DNA (cDNA).
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Comparative ct method, by Thermo Fisher Scientific (4 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (4 mentions)
Rnase free dnase 1, by Promega (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Dnase, by Promega (3 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Easy spin total rna extraction kit, by GeneAll (2 mentions)
Trizol extraction, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Promega (1 mentions)
Taqman microrna rt kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman chemistry, by Thermo Fisher Scientific (1 mentions)
7900ht real time pcr machine, by Thermo Fisher Scientific (1 mentions)
Rneasy column cleanup, by Qiagen (1 mentions)
High capacity cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Sodium dodecyl sulfate (sds), by Thermo Fisher Scientific (1 mentions)
16 protocols using multiscribe mulv reverse transcriptase
1
RNA Extraction and qPCR Analysis
2
qRT-PCR Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using Trizol (Life Technologies, Carlsbad, CA) and treated with DNase (Promega, Madison, WI). Two microgram of total RNA was reverse transcribed with MultiScribe TM MuLV reverse transcriptase (Life Technologies, Carlsbad, CA) and 40 ng of cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR) amplification (Life Technologies, Carlsbad, CA) with SYBR green PCR master mix (Life Technologies, Carlsbad, CA). Negative controls were included in samples where no reverse transcriptase was added for each RNA sample. The relative gene expression levels were normalized according to 18 S (F 5′ CGCCGCTAGAGGTGAAATTCT and R 5′ CGAACCTCCGACTTTCGTTCT) and/or HPRT1 (F 5′ TGACACTGGCAAAACAATGCA 3′ and R 5′ GGTCCTTTTCACCAGCAAGCT 3′). Primers used included TCEA3 F 5′TGTCCTTGGCCAAAGTCC and R 5′GGAGAAAGGCCTGCTTCTG, TCEA1 (F 5′ GAATGACAGCAGAGGAAATGG 3′ and R 5′ CATTGGTTCTTCAGCACTACG 3′), BAX F 5′ GCTGCAGAGGATGATTGC and R 5′ CCTTGAGCACCAGTTTGC and BCL2 F 5′ TGGCCTTCTTTGAGTTCG and R 5′ TCCGTTATCCTGGATCCA. Quantitative real-time reverse transcriptase PCR (qRT-PCR) data were calculated using the comparative Ct method (Life Technologies, Carlsbad, CA). Standard deviations were calculated from the mean of the ΔCt values calculated from at least two independent RNA samples.
3
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from white blood cells was extracted using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to manufacturer’s protocol. cDNA was synthesized from 0.5 ug of total RNA using random primers and MultiScribeTM MuLV reverse transcriptase (Applied Biosystems, Foster City, CA, USA). For mature miR-1976, 20 ng of RNA were reverse transcribed by using a Taqman MicroRNA RT kit (Applied Biosystems) and miRNA-specific primer sets supplied by the manufacturer. Quantitative real time PCR (qPCR) was performed with the ABI prism 7900HT Sequence Detection System (Applied Biosystems) using Taqman probes. Both mRNAs and miRNAs relative expression was calculated with the 2-ΔΔCT method and normalized using GAPDH and U48 mature miRNA, respectively.
4
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue using the Easy-Spin Total RNA extraction kit (iNtRon Biotech, Seoul, Korea). Following incubation with RNase-free DNase I (Promega, Madison, WI), reverse transcription was performed using a random primer and MultiScribeTM MuLV reverse transcriptase (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. cDNA was subjected to real-time PCR on a CFX96TM Real-Time PCR Detection System (Bio-Rad Laboratories, CA, USA) using SYBR Green I as a double-strand DNA-specific binding dye. After the reaction was complete, specificity was verified by melting curve analysis. Quantification was performed by comparing Ct values of each sample after normalization to GAPDH.
5
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As above, brains from each group were collected 10 min after the end of a 10-min FST (N = 4–5/group/treatment), and frozen immediately on dry ice. Brain regions of interest were punched using 0.5 mm ID biopsy corer (Fine Science Tools, Foster City, CA, USA) and kept at −80°C until extraction. mRNA isolation was performed using Qiazol (Trizol-chloroform) extraction with RNeasy column clean-up (Qiagen, Valencia, CA, USA). Samples were stored at −80°C in 1 mM sodium citrate, pH 6.4 (Life Technologies, Grand Island, NY, USA) prior to cDNA synthesis. mRNA concentrations were measured using spectrophotometry and diluted to the same concentration for all samples. cDNA synthesis was preformed with MultiScribe™ MuLV reverse-transcriptase following the protocol for the high capacity cDNA synthesis kit (Life Technologies). cDNA was stored at −20°C. cDNA synthesis reaction was preformed in triplicate for vHC samples. Assays were performed using the TaqMan chemistry and off the shelf assays from Life Technologies. Assay IDs were: Gapdh-Mm99999915_g1 and cFos-Mm00487425_m1. Samples were run in triplicate on a Life Technologies 7900HT real-time PCR machine with a 20 μl reaction volume. Samples were compared using the ΔΔCT method of relative quantification. GAPDH was used to normalize between biological replicates.
6
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol (Life Technologies) was used for RNA extraction from cells. Two micrograms of total RNA was treated with DNase (Promega, Madison, WI, USA) and reverse transcribed with MultiScribe MuLV reverse transcriptase (Life Technologies). Forty nanograms cDNA was used for qPCR amplification (Life Technologies) with SYBR green PCR master mix (Life Technologies). Negative controls included no RT samples where no reverse transcriptase was added for each RNA sample. All quantitative RT-PCR (qRT-PCR) was performed in triplicate and three independent RNA samples were assayed for each time point. qRT-PCR data were calculated using the comparative Ct method (Life Technologies). Standard deviations from the mean of the [Δ] Ct values were calculated from three independent RNA samples. Primers used are listed in Supplemental Table 1 . Where possible, intron spanning primers were used. qRT-PCR gene expression data are shown using the format of relative gene expression (Relative Fold Change). A fold change was calculated for each sample pair and then normalized to the fold change observed at HPRT and/or 18s rRNA.
7
Quantification of mcrA and 16S rRNA Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis was performed with the mcrA-specific reverse primer mcrA-rev (87 (link)) and 16S rRNA gene reverse primer 806R (88 (link)), 0.5 mg template mRNA or total RNA, and Multi Scribe MuLV reverse transcriptase (200 U; Life Technologies, Foster City, CA, USA) incubated at 25°C for 20 min followed by at 37°C for 120 min, and enzyme inactivation at 80°C for 5 s. The cDNAs generated with mcrA-specific or 16S rRNA gene primers were quantified with quantitative real-time PCR (qRT-PCR), using SYBR Green as described previously (33 (link)). For mcrA, two runs of qRT-PCR with a primer set of mlas/mcrA-rev were performed (two experimental replicates), and for each qRT-PCR run, three replicates of cDNA samples were used. For 16S rRNA, three runs of qRT-PCR with a primer set of 16S rRNA 515F/806R were performed (three experimental replicates), and for each qRT-PCR run, three replicates of cDNA samples were used.
8
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared with the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions. The extracted RNA (100 ng to 1 mg) was reverse transcribed into cDNA (reverse transcription) via Taqman reverse transcription reagents, including random hexamers, oligo (dT), and MultiScribe MuLV reverse transcriptase (Applied Biosystems). qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using Fast SYBR Green master mix (Applied Biosystems). All annealing steps were carried out at 60°C. Relative mRNA expression of target genes was calculated with the comparative CT method. All target genes were normalized to Gapdh in multiplexed reactions performed in triplicate. Differences in CT values (ΔCT = CT gene of interest − CT Gapdh in experimental samples) were calculated for each target mRNA by subtracting the mean value of GAPDH (relative expression = 2–ΔCT) (Kim et al., 2010 (link)). Information on primer sets (Eurofins) used in this study is listed in Table S1 .
9
Quantifying RhoA Gene Expression in Rat Trabecular Meshwork
10
Quantitative Real-Time PCR Protocol for FLS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For performing quantitative real-time PCR (qRT-PCR), RNA was isolated from FLS with peqGold TriFast (Peqlab, Erlangen, Germany), followed by first-strand cDNA synthesis using the MultiScribe™ MuLV reverse transcriptase (Applied Biosystems, Foster City, CA, USA), both according to manufacturer’s instruction. Relative gene expression was assessed by qRT-PCR using the Applied Biosystems 7500 fast-real-time-PCR System (Applied Biosystems) with SYBR® Select Master Mix (ThermoFisher Scientific) as detection method, according to the manufacturer’s manual. Samples and the housekeeping gene GAPDH as endogenous control were analyzed in duplicates. For evaluation, relative expression (ΔCt) and ΔΔCt method was utilized. Primers used were GAPDH (fwd 5′-TCCTGTTCGACAGTCAGCCGC-3′, rev 5′-CGCCCAATACGACCAAATCCGT-3′), IL-6 (fwd 5′-AGAGCTGTGCAGATGAGTACAA-3′, rev 5′-GCGCAGAATGAGATGAGTTGTC-3′) and IL-8 (fwd 5′-AGCACCAGCCAACTCTCACT-3′, rev 5′-CGTTAACTGCATCTGGCTGA-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!