Sheep blood agar plates

Manufactured by HiMedia

Sourced in India

Sheep blood agar plates are a type of microbiology culture media used for the isolation and identification of various microorganisms. These plates contain sheep blood, which provides essential nutrients and growth factors for certain bacteria and fungi. The presence of sheep blood also allows for the detection of hemolytic activity, which is a characteristic used to differentiate and identify specific microorganisms.

Automatically generated - may contain errors

Lab products found in correlation

Tryptic soy broth (tsb), by HiMedia (1 mentions) Tween 80 solution, by Samchun (1 mentions) Trypticase soy broth tsb, by HiMedia (1 mentions) K file, by Mani (1 mentions) Anaerocult a system, by Merck Group (1 mentions)

6 protocols using sheep blood agar plates

Decontamination and Analysis of Root Canals

Check if the same lab product or an alternative is used in the 5 most similar protocols

Diamond milling (Tees Kavan, Iran) was used to remove the crown and end of the root.
Normal saline (sodium chloride, 0.9%) (Shahid Ghazi co., Tabriz, Iran) and 5% sodium hypochlorite (Paxan Co., Tehran, Iran) were used for irrigation of teeth.
EDTA 17% (Maraboon, Iran) was used to remove the smear layer.
The standard strain of E. faecalis (ATCC29212), trypticase soy broth, TSB (HiMedia Laboratories, Mumbai, India), PBS (phosphate-buffered saline), sheep blood agar plates (HiMedia Laboratories, Mumbai, India), and Eppendorf tube (Amin Co., Iran) were used for microbiologic experiments.
A microtome device (Nemo, Iran) was used to cut teeth.
The 445 nm diode laser (SiroLaser Blue, Sirona Dental System GmbH, Germany) and erbium chromium laser (Biolase, Waterlase/USA) were used for radiation.

Hendi S.S., Ahmadyani E., Alikhani M.Y., Farhadian M, & Mirzaei A. (2022). Antibacterial Effects of the Novel Blue Laser and Erbium Chromium Laser on Enterococcus Faecalis in Root Canal Dentin with Different Thicknesses. International Journal of Dentistry, 2022, 6119464.

+ Open protocol

+ Expand

Bacterial Hemolysis Assay on Blood Agar

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly cultured bacteria were streaked onto sheep blood agar plates (HiMedia, India). After 18–24 h of incubation at 37 °C, bacteria were categorized for the pathogenicity by changed color of blood in the medium. Color of blood changed from red to yellow gray/dark green and yellow/transparent was considered α-hemolysis and β-hemolysis, respectively; however, no change in color of the blood came under γ-hemolysis (Carey et al., 2007 ).

Rahman Z, & Singh V.P. (2016). Assessment of heavy metal contamination and Hg-resistant bacteria in surface water from different regions of Delhi, India. Saudi Journal of Biological Sciences, 25(8), 1687-1695.

+ Open protocol

+ Expand

Endodontic Procedure for E. faecalis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following materials were used: diamond disk (DFS Diamon Co., Germany) for removing the crown, K-files (Mani Inc., Japan), and rotary files (V-Taper Gold, Shanghai Fanta Dental, China) for preparation of the root canals. Normal saline (sodium chloride, 0.9%) (Shahid ghazi Co., Tabriz, Iran), EDTA 17% (Maraboon, Iran), and 5% sodium hypochlorite (Paxan Co., Tehran, Iran) for irrigation of root canals. Eppendorf tube (Amin Co., Iran) and Acryle (Acropars Co., Iran) for fixing the roots. Standard strain of E. faecalis (ATCC29212), Trypticase soy broth; TSB (Hi-Media Laboratories, Mumbai, India), Tween 80 solution (Samchun Pure Chemical, Korea), PBS (Phosphate-buffered saline), and sheep blood agar plates (Hi-Media Laboratories, Mumbai, India) for microbiologic experiments. Sodium thiosulfate solution (Samchun Pure Chemical, Korea) for neutralizing sodium hypochlorite solution. ZetaSizer Nano ZS (ZEN3600) (Malvern, United Kingdom) for measuring Zeta potential. Erbium chromium laser (Biolase, Waterlase, USA).

Hendi S.S., Amiri N., Poormoradi B., Alikhani M.Y., Afshar S, & Farhadian M. (2021). Antibacterial Effects of Erbium Chromium Laser along with/without Silver Nanoparticles in Root Canals Infected by Enterococcus faecalis. International Journal of Dentistry, 2021, 6659146.

+ Open protocol

+ Expand

Gardnerella vaginalis Growth and Protein Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gardnerella vaginalis was grown overnight in sBHI medium (pH 6.5) and further sub-cultured independently in the same medium, both at pH 6.5 and pH 3.5 under anaerobic conditions using Anaerocult^® A system (Merck Millipore, Germany) in an anaerobic jar as mentioned above. An equal volume of the culture was taken to measure the absorbance (OD_{595 nm}) over time. Cells were pelleted at 4,000 × g for 10 min and stored at –20°C until preparation of whole cell lysates and determination of protein concentration and protein profile analysis by SDS-PAGE as described later. The growth curve analysis experiment including estimation of protein concentration and subsequent protein profile analysis was performed thrice. Also, cells collected at 48 h time point were plated on sheep blood agar plates (HiMedia, India) and incubated further under anaerobic conditions for 48 h at 37°C to determine the colony forming units (CFU). The CFU analysis was performed twice. The results were analyzed for statistical significance as mentioned in the section on statistical analysis.

Shishpal P., Patel V., Singh D, & Bhor V.M. (2021). pH Stress Mediated Alteration in Protein Composition and Reduction in Cytotoxic Potential of Gardnerella vaginalis Membrane Vesicles. Frontiers in Microbiology, 12, 723909.

+ Open protocol

+ Expand

Detecting ESBL-encoding Genes in Bacteria

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial genomic DNA of suspected ESBLs isolates was extracted directly from 24 h colonies on 5% sheep blood agar plates (Hi-Media, India) by boiling a dense suspension in sterile distilled water for 10 min and centrifugation for 2 min at 13,000 ×g.[13 (link)] ESBL-encoding genes were recognized using specific primers for the blaTEM gene (forward primer: 5’AGTATTCAACATTTCCGTGTCG3’ and reverse primer 5’GCTTAATCAGTGAGGCACCTATC3’) and blaCTX-M gene (forward primer: 5’CGTGCTGATGAGCGCTTTGC 3’ and reverse primer 5’AGATCACCGCGATATCGTTG 3’). DNA amplification was performed using the following thermal cycling conditions: Initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 95°C for 30 s, annealing temperature of 59°C for bla CTX-M and 61°C for blaTEM for 25 s and extension at 72°C for 45 s followed by a final extension at 72°C for 10 min. PCR products were analyzed by agarose gel electrophoresis for 1 h at 80 V in 1.5% agarose gel containing 0.05 mg/L safe view to detect specific bands in 0.5X TAE buffer. Primers were purchased from Metabion (Munich, Germany), Master Mix from Amplicon and other molecular materials were bought from Cinnagen, Iran. K. pneumoniae ATCC 7881 was used as a positive control strain.

Maleki N., Tahanasab Z., Mobasherizadeh S., Rezaei A, & Faghri J. (2018). Prevalence of CTX-M and TEM β-lactamases in Klebsiella pneumoniae Isolates from Patients with Urinary Tract Infection, Al-Zahra Hospital, Isfahan, Iran. Advanced Biomedical Research, 7, 10.

+ Open protocol

+ Expand

Identification of Group A Streptococcus

Check if the same lab product or an alternative is used in the 5 most similar protocols

The throat sample was cultured on 5% sheep blood agar plates (Himedia, India) by rolling the swab over a small area of the plate and streaking the sample with a sterile loop, then incubated at 37 °C with 5% CO₂ atmosphere for 24 h. A catalase test and gram staining were performed on colonies having ß-hemolysis. All catalase-negative and gram-positive cocci were subcultured for 24 h at 37 °C on 5% fresh blood agar plates with a Bacitracin disk in a 5% CO₂ atmosphere to differentiate colonies suspected to be S. pyogenes. Any zone of inhibition around the bacitracin disk was a candidate for Pyrrolidonyl arylamidase (PYR) tests, change of color to red /purple was confirmed culture positive for GAS. [18 , 19 ].

Barsenga S., Mitiku H., Tesfa T, & Shume T. (2022). Throat carriage rate, associated factors, and antimicrobial susceptibility pattern of group A Streptococcus among healthy school children in Jigjiga City, Eastern Ethiopia. BMC Pediatrics, 22, 227.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!