Anti brd4 a301 985a

We provide a brief summary of publicly available datasets being re-analysed, for improved context of our analysis and results. Briefly, HRAS IP-MS samples were immunoprecipitated (Anti-Flag M2 Magnetic Beads, Sigma) from point mutant baits (via site-directed mutagenesis) and WT baits after using creation of stable cell lines (CAL-33, HET-1A and SCC-25) via lentivirus incorporation^{17 (link)}. For KRAS IP-MS cells were transfected with pCEFL-FLAG-KRAS^WT, or with pCEFL-FLAG-KRAS^G12C. Cell lysates (with the addition of protease and phosphatase inhibitors) underwent immunoprecipitation (anti-FLAG M2 conjugated agarose beads, Sigma-Aldrich; A2220). For elution and digestion 2 M Urea was used as well as 50 mM Tris-HCl (pH7.5), trypsin and DTT (for digestion).Finally, the BRD4 IP-MS was performed on nuclear extracts using an Anti‐BRD4 (A301‐985 A, Bethyl Labs) antibody (50 µg) was coupled to 100 µl AminoLink resin (Thermo Fisher Scientific).

Chromatin Immunoprecipitation (ChIP) was performed as described [27 (link)]. For each ChIP 4 µg anti-BRD2 (A302-583A) or anti-BRD4 (A301-985A) from Bethyl Laboratories and control Rabbit IgG SC-2027 from Santa Cruz Biotechnology were used. ChIP sequences were generated with the use of the Illumina Hiseq 2000 genome analyzer. Mapped reads were visualized in heatmaps and profiles using deepTools2 v2.4.0 with the UCSC hg38 refGene coordinates. QPCR of the ARID1B region was performed with ARID1B1.1_Forward, CGCCCACAATGTGCTTTAACGG; ARID1B1.1_Reverse, AGGAAAAACCCACTCGCTTGTC.