Taqman geneassays kits

Total cellular RNA was extracted from cells using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. Real‐time RT‐PCR was performed on an ABI7500 Thermocycler using Platinum ThermoScript One‐Step system (Invitrogen, Zug, Switzerland). All mouse gene‐specific mRNA levels were determined using commercial TaqMan GeneAssays (Applied Biosystems, Zug, Switzerland): Eif1a (Mm00456651_m1), Sucnr1 (Mm00519024_m1), Tnf (Mm00443258_m1), Il1b (Mm00434228_m1), Il4 (Mm00445259_m1), Il5 (Mm01290072_g1), Il13 (Mm00434206_g1), Il17 (Mm00521423_m1) and Ifng (Mm99999071_m1). For measurement of human EF1A mRNA, primers and probes (Eurogentec, Liege, Belgium) were designed with primerexpress software (Applied Biosystems, Zug, Switzerland) (forward, 5′‐TTTGAGACCAGCAAGTACTATGTGACT‐3′; reverse 5′‐TCAGCCTGAGATGTCCCTGTAA‐3′; probe 5′‐TCATTGATGCCCCAGGACACAGAGAC‐3′). The expression of gene‐specific human SUCNR1 mRNA was measured with commercial TaqMan GeneAssays kits (Applied Biosystems, Hs00263701_m1).

Total RNA was extracted from cells using the RNeasy Mini kit (QIAGEN). cDNA was prepared using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems), and a SimpliAmp thermal cycler and the Quant Studio 12K Flex system (Applied Biosystems) were used for quantitative PCR. The results are presented as relative quantification versus the basal condition using the comparative Ct method.
For quantification of mouse GPR91 and human EF-1α, primers and probes were designed and purchased from Microsynth (mGPR91 forward [5′-TCACTGTGGTGTTTGGCTACCT-3′], reverse [5′-CCCTTATCATTGGCATAACTCTTTATC-3′], and probe [5′-TTTGCTTTCCTGTGCACCCTTCCCAT-3′]; hEF-1α forward [5′-TTTGAGACCAGCAAGTACTATGTGACT-3′], reverse [5′-TCAGCCTGAGATGTCCCTGTAA-3′], and probe [5′-TCATTGATGCCCCAGGACACAGAGAC-3′]). Expression of all other genes was measured using Taqman gene assays kits (Applied Biosystems): human GPR91 (Hs00263701-m1), mouse IL-1β (Mm00434228_m1), mouse β-glucuronidase (Mm00446953_m1), mouse inducible nitric oxide synthase (Mm00440502_m1), mouse F4/80 (Mm00802529_m1), and mouse TLR4 (Mm00445273_m1).