CT26 or MC38 were seeded onto 6 well-plates at a density of 5×105 cells/well. The next day, cells were transfected with shIDO or shScr (1μg/well) using Lipofectamine 3000 (Thermofisher). The pLKO.1-puro lentiviral vector containing the 21-mer shRNA sense sequence CGTCTCTCTATTGGTGGAAAT (shIDO#9), pEQshIDO, or scrambled shRNA (shScr) sequence (Sigma) were used. Twenty-four hours after transfection, cells were stimulated with murine IFN-γ (100ng/ml, Peprotech) and/or TNF-α (10ng/ml, Peprotech). Forty-eight hours after IFN-γ treatment, cells were lysed in protein extraction buffer (150 mM NaCl, 10 mM Tris, 1mM EDTA, 1% NP-40, 1mM EGTA, 50 mM NaF containing protease and phosphatase inhibitor cocktail), subjected to SDS-PAGE, and subsequently transferred to PVDF membrane (Invitrogen). The membranes were probed with mouse anti-mouse IDO (05-840, Millipore; 1:500 dilution) or rabbit anti-mouse β-actin (4970, Cell Signaling; 1:1000 dilution) antibodies, followed by goat anti-mouse polyvalent immunoglobulins (IgG, IgA, IgM) peroxidase conjugate (A0412, Sigma; 1:2000 dilution) or goat anti-rabbit IgG (whole molecule) peroxidase conjugate (A6154, Sigma; 1:2000 dilution), respectively. Bioluminescence was catalyzed using a Quick Spray Chemiluminescent HRP Antibody Detection Reagent (Thomas Scientific, E2400), and bands were detected in a luminescent image analyser PXi (Syngene).
A0412
Manufactured by Merck Group
A0412 is a laboratory equipment product manufactured by the Merck Group. It is designed to perform specific functions in a laboratory setting. The core function of this product is to facilitate various laboratory processes, but a detailed description cannot be provided while maintaining an unbiased and factual approach without extrapolation.
Automatically generated - may contain errors
Lab products found in correlation
Murine ifn γ, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Pvdf membrane, by Thermo Fisher Scientific (2 mentions)
A6154, by Merck Group (2 mentions)
Tnf α, by Thermo Fisher Scientific (2 mentions)
Scrambled shrna shscr, by Merck Group (2 mentions)
Quick spray chemiluminescent hrp antibody detection reagent, by Thomas Scientific (2 mentions)
2 protocols using a0412
1
Targeted IDO Knockdown in Cancer Cells
2
Targeted IDO Knockdown in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CT26 or MC38 were seeded onto 6 well-plates at a density of 5×105 cells/well. The next day, cells were transfected with shIDO or shScr (1μg/well) using Lipofectamine 3000 (Thermofisher). The pLKO.1-puro lentiviral vector containing the 21-mer shRNA sense sequence CGTCTCTCTATTGGTGGAAAT (shIDO#9), pEQshIDO, or scrambled shRNA (shScr) sequence (Sigma) were used. Twenty-four hours after transfection, cells were stimulated with murine IFN-γ (100ng/ml, Peprotech) and/or TNF-α (10ng/ml, Peprotech). Forty-eight hours after IFN-γ treatment, cells were lysed in protein extraction buffer (150 mM NaCl, 10 mM Tris, 1mM EDTA, 1% NP-40, 1mM EGTA, 50 mM NaF containing protease and phosphatase inhibitor cocktail), subjected to SDS-PAGE, and subsequently transferred to PVDF membrane (Invitrogen). The membranes were probed with mouse anti-mouse IDO (05-840, Millipore; 1:500 dilution) or rabbit anti-mouse β-actin (4970, Cell Signaling; 1:1000 dilution) antibodies, followed by goat anti-mouse polyvalent immunoglobulins (IgG, IgA, IgM) peroxidase conjugate (A0412, Sigma; 1:2000 dilution) or goat anti-rabbit IgG (whole molecule) peroxidase conjugate (A6154, Sigma; 1:2000 dilution), respectively. Bioluminescence was catalyzed using a Quick Spray Chemiluminescent HRP Antibody Detection Reagent (Thomas Scientific, E2400), and bands were detected in a luminescent image analyser PXi (Syngene).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!