Z taq

Total RNA from each cell sample was isolated using RNeasy plus mini kit and oligo dT‐primed cDNA were synthesized from total RNAs using the Super Script III kit (Life Technologies). Each cDNA was amplified by PCR with the following primer sets and Taq polymerase (z‐Taq; Takara Bio, Tokyo, Japan). Primers for p14^ARF were 5′‐TGCTGATGCTACTGAGGAGCC‐3′ and 5′‐CGCGGCCGCTCAGCCAGGTCCACGGGCAGA‐3′, for ATPAF1 were 5′‐GGCTCAGTCCTGTCCAACAT‐3′ and 5′‐GTGCCTCAGCAACATTCAGA‐3′, for UCP‐2 were 5′‐CAAATGAGCTTTGCCTCTGTC‐3′ and 5′‐TCTGTCATGAGGTTGGCTTTC‐3′, and for Actin were 5′‐CCTCATGAAGATCCTCACCGA‐3′ and Rv 5′‐TGCCAATGGTGATGACCTGG‐3′.

For extemporaneous genotyping, yolk sacs were collected and placed into 1.5 ml tubes containing Rapid Digestion Buffer (10 mM EDTA pH8.0 and 0.1 mM NaOH), then placed in a thermomixer at 95 °C for 10 min with shaking at 900 rpm. While the yolk sacs were incubating, the PCR master mix was prepared using Z-Taq (Takara R006B) and primers (Table S1) and aliquoted into PCR tubes. The tubes containing lysed yolk sacs were then placed on ice to cool briefly and quickly centrifuged at high speed. The lysate (1μl) was placed into the reaction tubes and cycled 32× (2 s at 98 °C, 2 s at 55 °C, 15 s at 72 °C). Twenty microliters of the PCR reaction were loaded onto a 1.5% agarose gel and electrophoresis was run at 120 V for 10 min. When samples could be kept for some time, a conventional genotyping protocol was applied with a Tail Digestion Buffer (10 mM Tris pH8.0, 25 mM EDTA pH8.0, 100 mM NaCl, 0.5% SDS) added to each yolk sac or tail clipping at 250μl along with 4μl Proteinase K at 20 mg/ml (EuroBio GEXPRK01–15) and incubated overnight at 55 °C. The samples were then incubated at 95 °C for 15 min to inactivate the Proteinase K and stored at −20 °C until ready for genotyping. Genotyping primers (Supplementary Data 1) were combined with Taq polymerase (Prospec ENZ-308) in 25μl reactions and cycled 2× with Ta = 64 °C and then cycled 32× with Ta = 62 °C.