I taq dna polymerase

The PCR reaction mixture, containing 0.8 mM dNTPs, 1.25 mM MgCl₂, 1.5 U of i-Taq DNA polymerase (iNtRON Biotechnology, South Korea), 10× PCR buffer (2 μL, 20 mM MgCl₂), and about 5 ng/μL of template DNA, was adjusted to 20 μL with sterile water. The primer sets were added 2.5 pmol each for L. gasseri, L. helveticus, and L. jensenii; 5 pmol for L. crispatus; and 10 pmol for L. acidophilus and L. gallinarum (forward and reverse, each). To optimize the multiplex PCR conditions, gradient PCR method with various annealing temperatures was tested twice to obtain precise conditions (from 54°C to 64°C and from 58°C to 63°C). The PCR reaction mixture conditions were as follows: initial denaturation at 94°C for 5 min followed by 40 cycles of amplification (denaturation at 94°C for 20 s, annealing at 63°C for 30 s, and extension at 72°C for 1.5 min) and a final extension step at 72°C for 7 min. The amplified products were then run on a 1.5% agarose gel with TAE buffer containing ethidium bromide and visualized using a Gel Documentation System (Bio-Rad, USA).

CAL-62, CAL-62/R, CAL-62/F, NK-92MI, and NK/F cells were lysed using TRIzol solution (Invitrogen, Carlsbad, CA, USA), and total RNA was extracted according to the manufacturer’s instructions. Reverse transcription was performed using the Revert Aid First Strand cDNA Synthesis kit (Fermentas, ON, Canada). PCR was carried out using i-Taq DNA polymerase (iNtRON Biotechnology, Seongnam, Korea) and a GeneAmp PCR system. The samples were denatured for 2 min at 94°C, followed by 40 cycles of amplification at 94°C for 20 s, 57°C for 10 s, and 72°C for 30 s. This was followed by a final elongation at 72°C for 5 min. The following primers were used: the effluc gene, forward: 5′-GCACAAGGCCATGAAGAGAT-3′, reverse: 5′-CTTCTTGCTCACGAACACCA-3′; the Rluc gene, forward: 5′-TATGATTCCGAGAAGCACGC-3′, reverse: 5′-TGATCCAGGAGGCGATATGA-3′; and GAPDH, forward: 5′-AGTGATGGCATGGACTGTGG-3′, reverse: 5′-GTCAAGGCTGAGAACGGGAA-3′. PCR products were separated by electrophoresis in an ethidium bromide-stained agarose gel.

Conventional PCR for the detection of A. platys was used to exclude A. platys coinfection. The reactions were conducted using 5 μL of the total DNA as a template and 20 μL of 0.4 pmol of each primer (Ana45F: 5′GTCGAACGGATTTTTGTCGT3′ and Ana671R: 5′GCCACTGGTGTTCCTCCTAA3′) [24 ], 300 μM of each dNTP, four units of iTaq DNA Polymerase (iNtRON Biotechnology, Kyungki-Do, South Korea), 1X PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl), 1.5 mM MgCl₂, and RNase-free water. The amplification was conducted in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The thermocycling steps consisted of one step for 10 min at 95°C followed by 35 cycles of 30 s at 94°C, 30 s at 55°C, and 45 s at 72°C, with a final extension step of 10 min at 72°C. Aliquots of the amplicons were detected using gel electrophoresis on 2.0% agarose gel stained with GelRed (Biotium, Hayward, CA, USA) and visualized under UV light (Syngene, Cambridge, UK).

Total RNA was extracted from cultured ST2 or OP9 cells using TRIzol™ reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. Samples of 5 μg total RNA were used for single strand cDNA synthesis using Superscript First-Strand cDNA Synthesis System (Invitrogen Life Technologies) according to the manufacturer’s instructions. After reverse transcription, RNA was degraded by Escherichia coli RNase H (Invitrogen Life Technologies). qPCR was performed in 20 μl reaction buffer containing 1.5 U i-Taq DNA polymerase (iNtRON Biotechnology, Seongnam, Korea), 1X PCR buffer (iNtRON), 2.5 mM each of dATP, dCTP, dGTP and dTTP (iNtRON) and 10 pM of each specific primer (NK-1: F 5′-TGGACTCTGATCTCTTCCCCAACA-3′ and R 5′-GGACCCAGATGACAAAGATGACCA-3′). Primers were purchased from Cosmo Genetech Co., Ltd. (Seoul, Korea). PCR products were electrophoretically separated on 1.5% (w/v) agarose gels (M.biotech, Inc., Hanam, Korea) and visualized after staining with RedSafe nucleic acid staining solution (iNtRON).

CAL-62 cells, CAL-62/Rluc cells, MDA-MB-231 and MDA-MB-231/Rluc cells and their respective EVs were lysed using a TRIzol solution (Invitrogen), and total RNA was extracted according to the manufacturer's instructions. Reverse transcription was performed as described elsewhere [77 (link)] using the RevertAid First Strand cDNA Synthesis kit (Fermentas). After denaturation of the samples for 2 minutes at 94°C, 40 cycles of 20 s at 94°C, 10 s at 57°C, and 30 s at 72°C were followed with an additional step of 5 minutes at 72°C. i-Taq DNA polymerase (iNtRON Biotechnology) and the GeneAmp PCR system were used. The primers were as follows: Rluc gene, forward, (5′-TATGAT TCCGAGAAGCACGC-3′, reverse, 5′-TGATCCAGGA GGCGATATGA-3′); and GAPDH (forward: 5′-AGTGATG GCATGGACTGTGG-3′; reverse: 5′-GTCAAGGCTGAG AACGGGAA-3′). The samples were separated by electrophoresis in an ethidium bromide-stained agarose gel. Gels were imaged on a UV transilluminator using a UVP GelDoc-IT imaging system.

Genomic DNA was isolated from well-expanded leaves from the field grown plants following the protocol of Rogers and Bendich [22 ]. All PCR amplifications were carried out in a 20 μl reaction volume containing 50 ng of template DNA, 800 μM of dNTPs, 2 mM of MgCl₂, 10 pmol each of forward and reverse primers and enzyme Taq polymerase (1 Unit, i-Taq DNA polymerase, Intron Biotechnology, Inc.). The PCR profile included initial denaturation at 94°C for 5 min followed by 36 cycles of 94°C for 30 sec, annealing at 62°C for 30 sec and 72°C for 1 min 30 sec and a final extension at 72°C for 12 min. For the purpose of sequencing, amplified fragments were cloned in the pGEM-T Easy TA cloning vector (Promega, Madison, USA). Sequencing was done by capillary electrophoresis on Applied Biosystems 3730 Genetic Analyzer. Sequencing of each sample was done in a minimum of 3 independent replicates to remove chances of any PCR related error. Sequence files were assembled and analysed using EditSeq, SeqMan and MegAlign software packages of DNAStar (DNAStar Inc.). For mapping, marker genotyping data of the mapping population were added to the existing map of B. juncea [21 (link)] using the program JoinMap version 4.0 [23 ]. Genome walk was performed using PCR genomic libraries based on the method described by GenomeWalker Universal Kit (Clontech Ltd.).