Total RNA was isolated from LE/6 cell using the TRIzol reagent (Invitrogen, Carlsbad, CA, United States). Two milligram of RNA from each sample was reverse-transcribed with the FastQuant RT Kit (With gDNase) (KR106) (Tiangen, Beijing, China). Real time polymerase chain reaction (PCR) was performed with an ABI ViiA 7 Dx instrument (Applied Biosystems, Foster City, CA, United States) using SuperReal PreMix Plus (SYBR Green) (FP205) PCR reagents (Tiangen, Beijing, China). The fold changes of the target genes were calculated using the 2-ΔΔCT method. The CTGF primers used for PCR reactions were: forward sequence, 5′- TAGCTGCCTACCGACTGGAA -3′; reverse sequence, 5′- CTTAGAACAGGCGCTCCACT -3′. The GAPDH primers used were: forward sequence, 5′- AGACAGCCGCATCTTCTTGT -3′; reverse sequence, 5′- CTTGCCGTGGGTAGAGTCAT -3′.
Abi viia 7 dx
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI ViiA 7 Dx is a real-time PCR system designed for diagnostic applications. It features a high-performance optical system, precise temperature control, and user-friendly software. The core function of the ABI ViiA 7 Dx is to enable accurate and reliable real-time PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Superreal premix plus sybr green fp205, by Tiangen Biotech (1 mentions)
Fastquant rt kit with gdnase, by Tiangen Biotech (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taqtm 2, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Transstart green qpcr supermix, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
3 protocols using abi viia 7 dx
1
Quantitative Analysis of CTGF Gene Expression
2
Validating SIGLEC15 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription polymerase chain reaction (RT-PCR) was conducted to validate the expression of SIGLEC15. Total RNA was extracted by using TRIzol reagent following the manufacturer’s instructions. cDNA synthesis was performed using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Japan). The following primers were designed using Primer5 software: SIGLEC15 forward 5′-GCCACCTAGTGACCGCCGAACT-3′, reverse 5′-CAGCGCCTTGAAGCCGAGA-3′; ACTB forward 5′-TGACGTGGACATCCGCAAAG-3′, reverse 5′-CTGGAAGGT GGACAGCGAGG-3′. RT-PCR was performed in a 96-well plate on an ABI VIIA7 Dx (Applied Biosystems, Foster City, CA, United States) using TB Green® Premix Ex TaqTM II (Takara, Japan) according to the manufacturer’s instructions. Each biological replicate was tested in triplicate. The relative expression values of SIGLEC15 were calculated using the 2–ΔΔCt method and normalized against the expression levels of ACTB gene.
3
RT-qPCR Analysis of Chemokine Expression in Irradiated Lung Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Invitrogen, Grand Island, NY, USA) from irradiation-treated LLC cells. Then, cDNA was synthesized using a ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) According to the manufacturer’s protocol. RT-qPCR was conducted using TransStart Green qPCR SuperMix (TaKaRa Bio Inc., Dalian, China) on an ABI ViiA7 Dx instrument (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA) to determine the messenger RNA (mRNA) expression levels of the target genes. The samples were amplified in three independent experiments.
The primer sequences for each gene were as follows: CXCL1, forward: 5'-TGGCTGGGATTCACCTCAA-3', reverse: 5'-GGCTATGACTTCGGTTTGG-3'; CXCL2, forward: 5'-TCAAGAATGGGCGGAAAG-3', reverse: 5'-CTTCAGGGTCAAGGCAAAC-3'; CCL5, forward: 5'-AAGATCTCTGCAGCTGCCCTCACCA-3', reverse: 5'-TGAGGGCAGCTGCAGAGATCTTCAT-3'; and GAPDH, forward: 5'-TGTTTCCTCGTCCCGTAG-3', reverse: 5'- CAATCTCCACTTTGCCACT-3. The 2-ΔΔCt method was used to calculate relative gene expressions, with GAPDH used as the reference gene for normalization.
The primer sequences for each gene were as follows: CXCL1, forward: 5'-TGGCTGGGATTCACCTCAA-3', reverse: 5'-GGCTATGACTTCGGTTTGG-3'; CXCL2, forward: 5'-TCAAGAATGGGCGGAAAG-3', reverse: 5'-CTTCAGGGTCAAGGCAAAC-3'; CCL5, forward: 5'-AAGATCTCTGCAGCTGCCCTCACCA-3', reverse: 5'-TGAGGGCAGCTGCAGAGATCTTCAT-3'; and GAPDH, forward: 5'-TGTTTCCTCGTCCCGTAG-3', reverse: 5'- CAATCTCCACTTTGCCACT-3. The 2-ΔΔCt method was used to calculate relative gene expressions, with GAPDH used as the reference gene for normalization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!