Cp01 200

We prepared injection mixes for Syt1-T2A-GAL4d-UAS-GCaMP6s, Syt1:GCaMP6s, and brp-T2A-QF2w according to Matthews et al., 2019 (link). Briefly, we generated DNA template for transcription of a new batch sgRNA (separate from that used for validation) by annealing two partially overlapping PCR primers (IDT, PAGE purified) and extending with NEBNext High-Fidelity polymerase (NEB, M0541S). We then transcribed each sgRNA in vitro using the HiScribe T7 Kit (NEB, E2040S) with 37°C incubation for 6 hours before treating with DNase at 37°C for 15 min, purifying with RNAse-free SPRI beads (Agencourt RNAclean XP, Beckman-Coulter A63987), and eluting in Ambion nuclease-free water (Life Technologies, AM9937). We prepared donor plasmids using the InFusion HD Kit (Clontech, 638910) and NucleoBond Xtra Midi EF Kit (Macherey-Nagel, 740420.10) and verified them via Sanger sequencing. We directly mixed recombinant Cas9 protein (300 ng/μL; PNA Bio, CP01–200), sgRNA (80 ng/μL) and donor plasmid (700 ng/uL) for embryo injection.

CEN was deleted employing a pair of gRNA using CRISPR/Cas9 technology, as described above. The target sequences were 5’-AGTATTGGAGGTGCTTAGAGCGG-3’ and 5’- TCTTCGAAGGCATGGATTGTCGG-3’, with PAM sequences underlined. To generate knockout animals, gRNAs were co-injected with Cas9 protein (CP01-200, PNA Bio) into one-cell stage embryos. Animal with CEN alleles are screened by PCR with primers CENseq1: 5’- CAGGGGAATAATAATTCAGGAGGTC-3’ and CENseq2: 5’- CTTATTTTAAAGCTGCCTTGACTCTG −3’. The wild-type allele is identified by PCR with primers CENseqF: 5’- GTTCATGTCACGATCACCAGCG-3’ CENseq2: 5’- CTTATTTTAAAGCTGCCTTGACTCTG −3’. Deletions were confirmed by Sanger sequencing (Eton Bioscience Inc.). The allele designation for this line is pd355.

The cebpd knockout allele was generated with a pair of guide RNAs using CRISPR/Cas9 technology. The gRNAs were designed using the CHOPCHOP website^{61 (link)}, and the target sequences were 5’- GCCCAGCTCATGTTGCATGGTGG-3’ and 5’CGAAGCCTCGTTTGGGTCGGCGG-3’, with PAM sequences underlined. gRNAs were generated through in vitro transcription using T7 RNA polymerase and co-injected with Cas9 protein (CP01-200, PNA Bio) into one-cell stage embryos. Animals with cebpd knockout alleles are screened by PCR with primers cebpdseq1: 5’-ACACTTTCCTTGGGACAGCC-3’ and cebpdseq2: 5’-CCATCATCGTCGTCTAACGTGTAAC-3’. The wild-type allele is identified by PCR with primers cebpdseq1: 5’-ACACTTTCCTTGGGACAGCC-3’ and cebpdseq3: 5’-CTCCATGGCCCAGCTCATG-3’. Deletions were confirmed by Sanger sequencing (Eton Bioscience Inc.). The allele designation for this line is pd354.